CU169470 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AATGTACCGTTAATATCAGGACACCGAATGGCCTTCTCTCTTCTGCTGCTGTTGTATCCATTGAGCAATTTAGCAGGATGAATGGCTTGACTGGGCAGAAAATGCAGAGGATATTTAAAGCCCTTGTGCATGAATCTGTTTACAACGATGCTCGCAGTTTGATAGAGTATTGCTTGTTTTAGATTCTTGTCAAGGGACAGTCTACTAAATTTTCATCCTTCACTCAGTGACA
BLAST of CU169470 vs. TrEMBL
Match: M5XJZ8_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa002078mg PE=4 SV=1) HSP 1 Score: 101.7 bits (252), Expect = 4.1e-19 Identity = 50/66 (75.76%), Postives = 56/66 (84.85%), Query Frame = 3
BLAST of CU169470 vs. TrEMBL
Match: A0A067KV78_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_05045 PE=4 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 5.0e-17 Identity = 45/58 (77.59%), Postives = 52/58 (89.66%), Query Frame = 3
BLAST of CU169470 vs. TrEMBL
Match: B9SRI4_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_1411120 PE=4 SV=1) HSP 1 Score: 94.4 bits (233), Expect = 6.6e-17 Identity = 47/66 (71.21%), Postives = 55/66 (83.33%), Query Frame = 3
BLAST of CU169470 vs. TrEMBL
Match: A0A022R6Z9_ERYGU (Uncharacterized protein OS=Erythranthe guttata GN=MIMGU_mgv1a001297mg PE=4 SV=1) HSP 1 Score: 94.4 bits (233), Expect = 6.6e-17 Identity = 45/58 (77.59%), Postives = 51/58 (87.93%), Query Frame = 3
BLAST of CU169470 vs. TrEMBL
Match: W9RGJ0_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_009368 PE=4 SV=1) HSP 1 Score: 93.6 bits (231), Expect = 1.1e-16 Identity = 47/74 (63.51%), Postives = 55/74 (74.32%), Query Frame = 3
BLAST of CU169470 vs. NCBI nr
Match: gi|778664216|ref|XP_011660244.1| (PREDICTED: uncharacterized protein LOC101209123 isoform X1 [Cucumis sativus]) HSP 1 Score: 120.9 bits (302), Expect = 9.4e-25 Identity = 61/75 (81.33%), Postives = 64/75 (85.33%), Query Frame = 3
BLAST of CU169470 vs. NCBI nr
Match: gi|659086615|ref|XP_008444028.1| (PREDICTED: uncharacterized protein LOC103487477 [Cucumis melo]) HSP 1 Score: 120.6 bits (301), Expect = 1.2e-24 Identity = 60/75 (80.00%), Postives = 64/75 (85.33%), Query Frame = 3
BLAST of CU169470 vs. NCBI nr
Match: gi|778664223|ref|XP_011660246.1| (PREDICTED: uncharacterized protein LOC101209123 isoform X3 [Cucumis sativus]) HSP 1 Score: 120.6 bits (301), Expect = 1.2e-24 Identity = 61/75 (81.33%), Postives = 64/75 (85.33%), Query Frame = 3
BLAST of CU169470 vs. NCBI nr
Match: gi|596277679|ref|XP_007225198.1| (hypothetical protein PRUPE_ppa002078mg [Prunus persica]) HSP 1 Score: 102.8 bits (255), Expect = 2.6e-19 Identity = 50/66 (75.76%), Postives = 56/66 (84.85%), Query Frame = 3
BLAST of CU169470 vs. NCBI nr
Match: gi|645223807|ref|XP_008218811.1| (PREDICTED: uncharacterized protein LOC103319093 [Prunus mume]) HSP 1 Score: 102.4 bits (254), Expect = 3.5e-19 Identity = 49/66 (74.24%), Postives = 56/66 (84.85%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|