CU168756 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGGTCGGGGGAAGGAGGATCGATGTTGGCAGAGGCAAGAAGGTCAGAGTAAGAAGAAGTCATAAAAGGATGAGTAGAGGAAGTGAAGGAGGGGTGAGAATTAGCAGAGGTGTCTAAGCTCCCGGAAGAGGAGGCCATGAGAG
BLAST of CU168756 vs. TrEMBL
Match: G0Z734_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=WRKY2 PE=2 SV=1) HSP 1 Score: 85.9 bits (211), Expect = 1.4e-14 Identity = 42/43 (97.67%), Postives = 42/43 (97.67%), Query Frame = -3
BLAST of CU168756 vs. TrEMBL
Match: M5W717_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa003333mg PE=4 SV=1) HSP 1 Score: 70.9 bits (172), Expect = 4.7e-10 Identity = 34/43 (79.07%), Postives = 38/43 (88.37%), Query Frame = -3
BLAST of CU168756 vs. TrEMBL
Match: W9RA34_9ROSA (Putative WRKY transcription factor 33 OS=Morus notabilis GN=L484_011135 PE=4 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 1.3e-07 Identity = 30/40 (75.00%), Postives = 35/40 (87.50%), Query Frame = -3
BLAST of CU168756 vs. TrEMBL
Match: A0A0B4SXU4_SOYBN (WRKY OS=Glycine max PE=2 SV=1) HSP 1 Score: 58.2 bits (139), Expect = 3.2e-06 Identity = 34/47 (72.34%), Postives = 37/47 (78.72%), Query Frame = -3
BLAST of CU168756 vs. TrEMBL
Match: A0A061GYP0_THECC (WRKY DNA-binding protein 33 isoform 1 OS=Theobroma cacao GN=TCM_042240 PE=4 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 4.1e-06 Identity = 29/46 (63.04%), Postives = 35/46 (76.09%), Query Frame = -3
BLAST of CU168756 vs. NCBI nr
Match: gi|525507238|ref|NP_001267657.1| (uncharacterized protein LOC101207158 [Cucumis sativus]) HSP 1 Score: 78.6 bits (192), Expect = 3.2e-12 Identity = 42/43 (97.67%), Postives = 42/43 (97.67%), Query Frame = -3
BLAST of CU168756 vs. NCBI nr
Match: gi|659114935|ref|XP_008457300.1| (PREDICTED: probable WRKY transcription factor 33 [Cucumis melo]) HSP 1 Score: 75.9 bits (185), Expect = 2.1e-11 Identity = 41/43 (95.35%), Postives = 41/43 (95.35%), Query Frame = -3
BLAST of CU168756 vs. NCBI nr
Match: gi|595841830|ref|XP_007208290.1| (hypothetical protein PRUPE_ppa003333mg [Prunus persica]) HSP 1 Score: 63.5 bits (153), Expect = 1.1e-07 Identity = 34/43 (79.07%), Postives = 38/43 (88.37%), Query Frame = -3
BLAST of CU168756 vs. NCBI nr
Match: gi|645215403|ref|XP_008231402.1| (PREDICTED: probable WRKY transcription factor 33 [Prunus mume]) HSP 1 Score: 63.5 bits (153), Expect = 1.1e-07 Identity = 34/43 (79.07%), Postives = 38/43 (88.37%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|