CU167925 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTGTGAAGGATGCGGGGGAGCGAGGTTTGTGCCATGTTATGAATGTGGAGGGAGCTGTAAAGTGATAAAAGGGGGCAACAAAAGGAGAGATGTGGAGCATGCAATGAGAATGGTTTGGCTCACTAGCCCTGCCTGTCATTGAAACTATCTTCGATGCCATCATAGAATAATGGAATTTGAATTGCTATTTTTATACTTCTT
BLAST of CU167925 vs. TrEMBL
Match: A0A0A0KQR0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G148770 PE=4 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 6.3e-08 Identity = 26/29 (89.66%), Postives = 26/29 (89.66%), Query Frame = 2
BLAST of CU167925 vs. TrEMBL
Match: A0A0A0KQR0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G148770 PE=4 SV=1) HSP 1 Score: 40.0 bits (92), Expect = 1.3e+00 Identity = 16/20 (80.00%), Postives = 17/20 (85.00%), Query Frame = 1
HSP 2 Score: 58.2 bits (139), Expect = 4.5e-06 Identity = 23/29 (79.31%), Postives = 25/29 (86.21%), Query Frame = 2
BLAST of CU167925 vs. TrEMBL
Match: A0A0K9R3A2_SPIOL (Uncharacterized protein OS=Spinacia oleracea GN=SOVF_117160 PE=4 SV=1) HSP 1 Score: 32.7 bits (73), Expect = 2.1e+02 Identity = 13/19 (68.42%), Postives = 13/19 (68.42%), Query Frame = 1
HSP 2 Score: 58.2 bits (139), Expect = 4.5e-06 Identity = 22/29 (75.86%), Postives = 25/29 (86.21%), Query Frame = 2
BLAST of CU167925 vs. TrEMBL
Match: M1AWL2_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400012263 PE=4 SV=1) HSP 1 Score: 31.6 bits (70), Expect = 4.6e+02 Identity = 13/19 (68.42%), Postives = 13/19 (68.42%), Query Frame = 1
HSP 2 Score: 58.2 bits (139), Expect = 4.5e-06 Identity = 22/29 (75.86%), Postives = 25/29 (86.21%), Query Frame = 2
BLAST of CU167925 vs. TrEMBL
Match: K4CPQ5_SOLLC (Uncharacterized protein OS=Solanum lycopersicum PE=4 SV=1) HSP 1 Score: 32.0 bits (71), Expect = 3.5e+02 Identity = 13/19 (68.42%), Postives = 13/19 (68.42%), Query Frame = 1
HSP 2 Score: 58.2 bits (139), Expect = 4.5e-06 Identity = 22/29 (75.86%), Postives = 25/29 (86.21%), Query Frame = 2
BLAST of CU167925 vs. NCBI nr
Match: gi|449452408|ref|XP_004143951.1| (PREDICTED: uncharacterized protein LOC101208965 [Cucumis sativus]) HSP 1 Score: 63.5 bits (153), Expect = 1.5e-07 Identity = 26/29 (89.66%), Postives = 26/29 (89.66%), Query Frame = 2
BLAST of CU167925 vs. NCBI nr
Match: gi|1009156011|ref|XP_015896017.1| (PREDICTED: uncharacterized protein LOC107429784 [Ziziphus jujuba]) HSP 1 Score: 59.7 bits (143), Expect = 2.2e-06 Identity = 25/45 (55.56%), Postives = 30/45 (66.67%), Query Frame = 2
BLAST of CU167925 vs. NCBI nr
Match: gi|659074080|ref|XP_008437411.1| (PREDICTED: uncharacterized protein LOC103482835 [Cucumis melo]) HSP 1 Score: 58.9 bits (141), Expect = 3.8e-06 Identity = 25/29 (86.21%), Postives = 25/29 (86.21%), Query Frame = 2
BLAST of CU167925 vs. NCBI nr
Match: gi|590679400|ref|XP_007040570.1| (Electron transporter, putative [Theobroma cacao]) HSP 1 Score: 58.2 bits (139), Expect = 6.5e-06 Identity = 25/45 (55.56%), Postives = 28/45 (62.22%), Query Frame = 2
BLAST of CU167925 vs. NCBI nr
Match: gi|835980770|ref|XP_012701791.1| (PREDICTED: tau-tubulin kinase 1 [Setaria italica]) HSP 1 Score: 57.8 bits (138), Expect = 8.5e-06 Identity = 29/51 (56.86%), Postives = 33/51 (64.71%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|