CU167885 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TCCATTAACGGGGGAGGGAAAATGGTTGGGGAGAAGAATCCATCTCTTCCCCAATGGATTCTTCTCCCAACCATTTCCTCCTCCGTTATTCCACTCAATTACCTCATACCCCTTTCATTATTCTCATCCCCATACTAGCTTCCATTGAAGCCTATCTGTACTTCTCACATGCATGGCATCCCCTTTTCCATATCTTCCCACTGTCTTTCCTTGTCGTCCTCATCATCTTCAA
BLAST of CU167885 vs. TrEMBL
Match: A0A0A0L8H3_CUCSA (3-ketoacyl-CoA synthase OS=Cucumis sativus GN=Csa_3G178510 PE=3 SV=1) HSP 1 Score: 122.1 bits (305), Expect = 2.9e-25 Identity = 57/59 (96.61%), Postives = 57/59 (96.61%), Query Frame = 3
BLAST of CU167885 vs. TrEMBL
Match: A0A0A0L5P9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G178515 PE=4 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 4.8e-07 Identity = 26/26 (100.00%), Postives = 26/26 (100.00%), Query Frame = -1
BLAST of CU167885 vs. NCBI nr
Match: gi|778688530|ref|XP_004148150.2| (PREDICTED: 3-ketoacyl-CoA synthase 5-like [Cucumis sativus]) HSP 1 Score: 116.3 bits (290), Expect = 2.3e-23 Identity = 57/59 (96.61%), Postives = 57/59 (96.61%), Query Frame = 3
BLAST of CU167885 vs. NCBI nr
Match: gi|659077803|ref|XP_008439394.1| (PREDICTED: 3-ketoacyl-CoA synthase 5-like [Cucumis melo]) HSP 1 Score: 108.6 bits (270), Expect = 4.8e-21 Identity = 54/59 (91.53%), Postives = 55/59 (93.22%), Query Frame = 3
BLAST of CU167885 vs. NCBI nr
Match: gi|700202177|gb|KGN57310.1| (hypothetical protein Csa_3G178515 [Cucumis sativus]) HSP 1 Score: 61.6 bits (148), Expect = 6.9e-07 Identity = 26/26 (100.00%), Postives = 26/26 (100.00%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|