CU167488 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTGATGCAGTAGTGTCATCCAACAAGGAGAGCCAGTGGGCAGCTCCGCTATCACCCATCGTATCCTCATCCTCCTTTGTGACGGAGGTGAGTCTGTGGAGAAGAAGCTGCCCCCCGTCACCATCAAGAACCATTGTTGGTTTGGTGTCTCTGTCACTCCTGATGGAACTGAAGGGAAATTGTAAAACACTGAAGGAGGGTGATTGTT
BLAST of CU167488 vs. TrEMBL
Match: A0A0A0LU55_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G002800 PE=3 SV=1) HSP 1 Score: 76.6 bits (187), Expect = 1.3e-11 Identity = 37/44 (84.09%), Postives = 37/44 (84.09%), Query Frame = -3
BLAST of CU167488 vs. NCBI nr
Match: gi|700208415|gb|KGN63511.1| (hypothetical protein Csa_1G002800 [Cucumis sativus]) HSP 1 Score: 76.6 bits (187), Expect = 1.8e-11 Identity = 37/44 (84.09%), Postives = 37/44 (84.09%), Query Frame = -3
BLAST of CU167488 vs. NCBI nr
Match: gi|449440598|ref|XP_004138071.1| (PREDICTED: DELLA protein GAI-like [Cucumis sativus]) HSP 1 Score: 76.6 bits (187), Expect = 1.8e-11 Identity = 37/44 (84.09%), Postives = 37/44 (84.09%), Query Frame = -3
BLAST of CU167488 vs. NCBI nr
Match: gi|659129006|ref|XP_008464481.1| (PREDICTED: DELLA protein GAI-like [Cucumis melo]) HSP 1 Score: 70.5 bits (171), Expect = 1.3e-09 Identity = 32/44 (72.73%), Postives = 36/44 (81.82%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|