CU167454 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CATGCTCTAGGAGTGTCTTACAAAATCAAAAGACTGAAGCAGCAATTTCTTCTACTTGAGAGGCTCGTTGGAAAACAAGAAAACTGCTCGGAATTCCGAAAATGAGGATAATGGACAAGTTGGCATTAGAGACTTTCTTTTGTTTCTGACACTGCTGAATAAACAAGTGGGAAGATATAATTCTCTGCAGGAGAAAACTGATGAACTCTGCCAAAGGATGCATGATTACGAAGCAAGTAGTAAAAAGTGGA
BLAST of CU167454 vs. TrEMBL
Match: A0A0A0LAI2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G239260 PE=4 SV=1) HSP 1 Score: 112.8 bits (281), Expect = 1.9e-22 Identity = 57/74 (77.03%), Postives = 60/74 (81.08%), Query Frame = 2
BLAST of CU167454 vs. TrEMBL
Match: A0A0A0LAI2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G239260 PE=4 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 3.7e-05 Identity = 27/27 (100.00%), Postives = 27/27 (100.00%), Query Frame = 1
HSP 2 Score: 111.3 bits (277), Expect = 5.7e-22 Identity = 56/74 (75.68%), Postives = 60/74 (81.08%), Query Frame = 2
BLAST of CU167454 vs. TrEMBL
Match: E5GBA4_CUCME (Putative uncharacterized protein OS=Cucumis melo subsp. melo PE=4 SV=1) HSP 1 Score: 55.5 bits (132), Expect = 3.7e-05 Identity = 27/27 (100.00%), Postives = 27/27 (100.00%), Query Frame = 1
HSP 2 Score: 67.8 bits (164), Expect = 7.2e-09 Identity = 34/68 (50.00%), Postives = 43/68 (63.24%), Query Frame = 2
BLAST of CU167454 vs. TrEMBL
Match: K4BI82_SOLLC (Uncharacterized protein OS=Solanum lycopersicum PE=4 SV=1) HSP 1 Score: 47.8 bits (112), Expect = 7.7e-03 Identity = 22/27 (81.48%), Postives = 24/27 (88.89%), Query Frame = 1
HSP 2 Score: 64.7 bits (156), Expect = 6.1e-08 Identity = 33/68 (48.53%), Postives = 42/68 (61.76%), Query Frame = 2
BLAST of CU167454 vs. TrEMBL
Match: A0A0V0IW85_SOLCH (Putative nucleoprotein TPR-like OS=Solanum chacoense PE=4 SV=1) HSP 1 Score: 48.5 bits (114), Expect = 4.5e-03 Identity = 23/27 (85.19%), Postives = 25/27 (92.59%), Query Frame = 1
HSP 2 Score: 64.7 bits (156), Expect = 6.1e-08 Identity = 33/68 (48.53%), Postives = 42/68 (61.76%), Query Frame = 2
BLAST of CU167454 vs. NCBI nr
Match: gi|778680446|ref|XP_011651318.1| (PREDICTED: myosin heavy chain, striated muscle [Cucumis sativus]) HSP 1 Score: 112.5 bits (280), Expect = 3.6e-22 Identity = 57/74 (77.03%), Postives = 60/74 (81.08%), Query Frame = 2
BLAST of CU167454 vs. NCBI nr
Match: gi|659133640|ref|XP_008466834.1| (PREDICTED: myosin heavy chain, striated muscle [Cucumis melo]) HSP 1 Score: 110.9 bits (276), Expect = 1.1e-21 Identity = 56/74 (75.68%), Postives = 60/74 (81.08%), Query Frame = 2
BLAST of CU167454 vs. NCBI nr
Match: gi|723682241|ref|XP_010318025.1| (PREDICTED: nucleoprotein TPR [Solanum lycopersicum]) HSP 1 Score: 67.8 bits (164), Expect = 1.0e-08 Identity = 34/68 (50.00%), Postives = 43/68 (63.24%), Query Frame = 2
BLAST of CU167454 vs. NCBI nr
Match: gi|657969948|ref|XP_008376709.1| (PREDICTED: spindle pole body component 110 [Malus domestica]) HSP 1 Score: 66.2 bits (160), Expect = 3.0e-08 Identity = 29/45 (64.44%), Postives = 37/45 (82.22%), Query Frame = 2
BLAST of CU167454 vs. NCBI nr
Match: gi|694346448|ref|XP_009357317.1| (PREDICTED: golgin subfamily A member 6-like protein 22 [Pyrus x bretschneideri]) HSP 1 Score: 66.2 bits (160), Expect = 3.0e-08 Identity = 29/45 (64.44%), Postives = 37/45 (82.22%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|