CU167178 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTCAGAGTCAATAATCCCTTTATAAACAGTAGCAAAAGAGCCACGCCCCCAAGTGTTGGATGAATCCACCTGTGGCATTGTTGAGCTCTTCGTAGCTAAAGATCCTGATATTCAGTACACCTAAAATGGAAGGGTCTTTTTCAACCACATCCGATTTCCTTTTCCTGAAATGGTAACAAATGAATAAAGTGAGAAGGAATAAGAGAAAG
BLAST of CU167178 vs. TrEMBL
Match: A0A0A0KZA1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G289620 PE=4 SV=1) HSP 1 Score: 112.1 bits (279), Expect = 2.8e-22 Identity = 54/58 (93.10%), Postives = 55/58 (94.83%), Query Frame = -2
BLAST of CU167178 vs. TrEMBL
Match: A0A0A0KZA1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G289620 PE=4 SV=1) HSP 1 Score: 36.2 bits (82), Expect = 1.9e+01 Identity = 16/16 (100.00%), Postives = 16/16 (100.00%), Query Frame = -3
HSP 2 Score: 73.6 bits (179), Expect = 1.1e-10 Identity = 39/58 (67.24%), Postives = 43/58 (74.14%), Query Frame = -2
BLAST of CU167178 vs. TrEMBL
Match: A0A0A0L0L8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G288620 PE=4 SV=1) HSP 1 Score: 32.7 bits (73), Expect = 2.1e+02 Identity = 14/16 (87.50%), Postives = 15/16 (93.75%), Query Frame = -3
BLAST of CU167178 vs. NCBI nr
Match: gi|778697635|ref|XP_011654364.1| (PREDICTED: G-type lectin S-receptor-like serine/threonine-protein kinase RLK1 [Cucumis sativus]) HSP 1 Score: 113.2 bits (282), Expect = 1.8e-22 Identity = 54/58 (93.10%), Postives = 55/58 (94.83%), Query Frame = -2
BLAST of CU167178 vs. NCBI nr
Match: gi|700198986|gb|KGN54144.1| (hypothetical protein Csa_4G289620 [Cucumis sativus]) HSP 1 Score: 113.2 bits (282), Expect = 1.8e-22 Identity = 54/58 (93.10%), Postives = 55/58 (94.83%), Query Frame = -2
BLAST of CU167178 vs. NCBI nr
Match: gi|778693110|ref|XP_011653579.1| (PREDICTED: G-type lectin S-receptor-like serine/threonine-protein kinase RLK1 [Cucumis sativus]) HSP 1 Score: 75.1 bits (183), Expect = 5.4e-11 Identity = 36/44 (81.82%), Postives = 39/44 (88.64%), Query Frame = -2
BLAST of CU167178 vs. NCBI nr
Match: gi|700198984|gb|KGN54142.1| (hypothetical protein Csa_4G288620 [Cucumis sativus]) HSP 1 Score: 74.7 bits (182), Expect = 7.0e-11 Identity = 39/58 (67.24%), Postives = 43/58 (74.14%), Query Frame = -2
BLAST of CU167178 vs. NCBI nr
Match: gi|778693113|ref|XP_011653580.1| (PREDICTED: G-type lectin S-receptor-like serine/threonine-protein kinase RLK1 [Cucumis sativus]) HSP 1 Score: 74.7 bits (182), Expect = 7.0e-11 Identity = 39/58 (67.24%), Postives = 43/58 (74.14%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|