CU166965 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TACGATATTCCATATAAAGTTGTCGAGGTCAATCCACTTAGTAAGAAAGAAAATTAAATGGTCGGATTATAAGAAGGTGCCTATACTGGTGGTTGATGGTGAACAGTTGGTTGACTCGTCAGCCATTATCGACCAGTTGAGCCACAGGGTTTTGCCAGATAAGAATGTTTCTTCTGTCTCTGAAGATGATGAAGAGACAAAGTGGCGCAGATGGGTAGATAATCACTTGGTACATATGTTATCACCAA
BLAST of CU166965 vs. Swiss-Prot
Match: PGES2_DANRE (Prostaglandin E synthase 2 OS=Danio rerio GN=ptges2 PE=2 SV=1) HSP 1 Score: 53.1 bits (126), Expect = 1.6e-06 Identity = 38/112 (33.93%), Postives = 51/112 (45.54%), Query Frame = 2
BLAST of CU166965 vs. TrEMBL
Match: A0A0A0LSA1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G025110 PE=4 SV=1) HSP 1 Score: 140.6 bits (353), Expect = 8.6e-31 Identity = 67/70 (95.71%), Postives = 69/70 (98.57%), Query Frame = 2
BLAST of CU166965 vs. TrEMBL
Match: A0A0D2RKR6_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_005G133000 PE=4 SV=1) HSP 1 Score: 119.0 bits (297), Expect = 2.7e-24 Identity = 53/68 (77.94%), Postives = 64/68 (94.12%), Query Frame = 2
BLAST of CU166965 vs. TrEMBL
Match: A0A0B0NPI4_GOSAR (Prostaglandin E synthase 2 OS=Gossypium arboreum GN=F383_16951 PE=4 SV=1) HSP 1 Score: 119.0 bits (297), Expect = 2.7e-24 Identity = 53/68 (77.94%), Postives = 64/68 (94.12%), Query Frame = 2
BLAST of CU166965 vs. TrEMBL
Match: A0A0D2REB1_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_005G133000 PE=4 SV=1) HSP 1 Score: 119.0 bits (297), Expect = 2.7e-24 Identity = 53/68 (77.94%), Postives = 64/68 (94.12%), Query Frame = 2
BLAST of CU166965 vs. TrEMBL
Match: A0A0D2SG65_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_005G133000 PE=4 SV=1) HSP 1 Score: 119.0 bits (297), Expect = 2.7e-24 Identity = 53/68 (77.94%), Postives = 64/68 (94.12%), Query Frame = 2
BLAST of CU166965 vs. NCBI nr
Match: gi|449439141|ref|XP_004137346.1| (PREDICTED: prostaglandin E synthase 2-like [Cucumis sativus]) HSP 1 Score: 140.6 bits (353), Expect = 1.2e-30 Identity = 67/70 (95.71%), Postives = 69/70 (98.57%), Query Frame = 2
BLAST of CU166965 vs. NCBI nr
Match: gi|659106979|ref|XP_008453485.1| (PREDICTED: prostaglandin E synthase 2-like [Cucumis melo]) HSP 1 Score: 136.0 bits (341), Expect = 3.0e-29 Identity = 65/70 (92.86%), Postives = 68/70 (97.14%), Query Frame = 2
BLAST of CU166965 vs. NCBI nr
Match: gi|763762931|gb|KJB30185.1| (hypothetical protein B456_005G133000 [Gossypium raimondii]) HSP 1 Score: 119.0 bits (297), Expect = 3.9e-24 Identity = 53/68 (77.94%), Postives = 64/68 (94.12%), Query Frame = 2
BLAST of CU166965 vs. NCBI nr
Match: gi|728833548|gb|KHG12991.1| (Prostaglandin E synthase 2 [Gossypium arboreum]) HSP 1 Score: 119.0 bits (297), Expect = 3.9e-24 Identity = 53/68 (77.94%), Postives = 64/68 (94.12%), Query Frame = 2
BLAST of CU166965 vs. NCBI nr
Match: gi|763762932|gb|KJB30186.1| (hypothetical protein B456_005G133000 [Gossypium raimondii]) HSP 1 Score: 119.0 bits (297), Expect = 3.9e-24 Identity = 53/68 (77.94%), Postives = 64/68 (94.12%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|