CU166591 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGGGAACTCCAAATACAATCTTTGAGCAGATACAACAGGAAAGAGCACGAAGAGATAGAAAGCCATTGAGAAGTGGAAAACAACTTTATCACGCTATCAAGATTGAACTTGATGACCTAATTCAGAGGACACATAATGGAATGGAT
BLAST of CU166591 vs. TrEMBL
Match: A0A0A0LS07_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G004180 PE=4 SV=1) HSP 1 Score: 78.2 bits (191), Expect = 3.1e-12 Identity = 39/46 (84.78%), Postives = 41/46 (89.13%), Query Frame = 3
BLAST of CU166591 vs. NCBI nr
Match: gi|449440646|ref|XP_004138095.1| (PREDICTED: uncharacterized protein LOC101204691 [Cucumis sativus]) HSP 1 Score: 78.6 bits (192), Expect = 3.4e-12 Identity = 39/46 (84.78%), Postives = 41/46 (89.13%), Query Frame = 3
BLAST of CU166591 vs. NCBI nr
Match: gi|659129099|ref|XP_008464528.1| (PREDICTED: WD repeat-containing protein 65-like [Cucumis melo]) HSP 1 Score: 78.2 bits (191), Expect = 4.4e-12 Identity = 39/46 (84.78%), Postives = 41/46 (89.13%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|