CU166418 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GATGTGATGTGGCTGTGAAACTTTTTGTAATGAATCCAGACAAGAAAATGGCCAAGATTTTATCAATGAAGTTGTTAGCATAGCCAAAACTTCACACATAAACATAGTCACACTCATAGGTTTCTGTTATGAGCAGAACAAAAGGGCTTTGATTTATGAATATATGGCTAAAGGGTCATTAGATAAGTACATATCCCACAACAGGCTGCAAGAAAATGATATGAAGTTAGGATTGGAACACACTTTATAA
BLAST of CU166418 vs. Swiss-Prot
Match: LRL25_ARATH (LEAF RUST 10 DISEASE-RESISTANCE LOCUS RECEPTOR-LIKE PROTEIN KINASE-like 2.5 OS=Arabidopsis thaliana GN=LRK10L-2.5 PE=3 SV=1) HSP 1 Score: 80.9 bits (198), Expect = 7.4e-15 Identity = 37/62 (59.68%), Postives = 46/62 (74.19%), Query Frame = 2
BLAST of CU166418 vs. Swiss-Prot
Match: LRL24_ARATH (LEAF RUST 10 DISEASE-RESISTANCE LOCUS RECEPTOR-LIKE PROTEIN KINASE-like 2.4 OS=Arabidopsis thaliana GN=LRK10L-2.4 PE=3 SV=1) HSP 1 Score: 79.7 bits (195), Expect = 1.6e-14 Identity = 36/60 (60.00%), Postives = 45/60 (75.00%), Query Frame = 2
BLAST of CU166418 vs. Swiss-Prot
Match: LRL21_ARATH (LEAF RUST 10 DISEASE-RESISTANCE LOCUS RECEPTOR-LIKE PROTEIN KINASE-like 2.1 OS=Arabidopsis thaliana GN=LRK10L-2.1 PE=3 SV=1) HSP 1 Score: 79.0 bits (193), Expect = 2.8e-14 Identity = 31/55 (56.36%), Postives = 46/55 (83.64%), Query Frame = 2
BLAST of CU166418 vs. Swiss-Prot
Match: LRL28_ARATH (LEAF RUST 10 DISEASE-RESISTANCE LOCUS RECEPTOR-LIKE PROTEIN KINASE-like 2.8 OS=Arabidopsis thaliana GN=LRK10L-2.8 PE=2 SV=2) HSP 1 Score: 77.8 bits (190), Expect = 6.2e-14 Identity = 34/65 (52.31%), Postives = 49/65 (75.38%), Query Frame = 2
BLAST of CU166418 vs. Swiss-Prot
Match: Y5392_ARATH (Probable receptor-like protein kinase At5g39020 OS=Arabidopsis thaliana GN=At5g39020 PE=2 SV=1) HSP 1 Score: 77.4 bits (189), Expect = 8.1e-14 Identity = 33/53 (62.26%), Postives = 44/53 (83.02%), Query Frame = 2
BLAST of CU166418 vs. TrEMBL
Match: A0A0A0LQF0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G042510 PE=3 SV=1) HSP 1 Score: 134.0 bits (336), Expect = 8.2e-29 Identity = 67/76 (88.16%), Postives = 68/76 (89.47%), Query Frame = 2
BLAST of CU166418 vs. TrEMBL
Match: A0A0A0LQT9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G042500 PE=3 SV=1) HSP 1 Score: 96.7 bits (239), Expect = 1.4e-17 Identity = 46/67 (68.66%), Postives = 57/67 (85.07%), Query Frame = 2
BLAST of CU166418 vs. TrEMBL
Match: A0A0D3CYJ1_BRAOL (Uncharacterized protein OS=Brassica oleracea var. oleracea PE=3 SV=1) HSP 1 Score: 90.5 bits (223), Expect = 1.0e-15 Identity = 39/55 (70.91%), Postives = 51/55 (92.73%), Query Frame = 2
BLAST of CU166418 vs. TrEMBL
Match: R0HIX1_9BRAS (Uncharacterized protein OS=Capsella rubella GN=CARUB_v10018466mg PE=3 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 3.0e-15 Identity = 38/58 (65.52%), Postives = 51/58 (87.93%), Query Frame = 2
BLAST of CU166418 vs. TrEMBL
Match: A0A0A0KR82_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G610370 PE=3 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 3.0e-15 Identity = 42/63 (66.67%), Postives = 51/63 (80.95%), Query Frame = 2
BLAST of CU166418 vs. NCBI nr
Match: gi|778657286|ref|XP_011650606.1| (PREDICTED: probable receptor-like protein kinase At5g39030 [Cucumis sativus]) HSP 1 Score: 134.8 bits (338), Expect = 6.9e-29 Identity = 67/76 (88.16%), Postives = 68/76 (89.47%), Query Frame = 2
BLAST of CU166418 vs. NCBI nr
Match: gi|700209044|gb|KGN64140.1| (hypothetical protein Csa_1G042510 [Cucumis sativus]) HSP 1 Score: 134.8 bits (338), Expect = 6.9e-29 Identity = 67/76 (88.16%), Postives = 68/76 (89.47%), Query Frame = 2
BLAST of CU166418 vs. NCBI nr
Match: gi|659066752|ref|XP_008459577.1| (PREDICTED: probable receptor-like protein kinase At1g67000 isoform X1 [Cucumis melo]) HSP 1 Score: 101.3 bits (251), Expect = 8.4e-19 Identity = 47/62 (75.81%), Postives = 55/62 (88.71%), Query Frame = 2
BLAST of CU166418 vs. NCBI nr
Match: gi|659066754|ref|XP_008459662.1| (PREDICTED: probable receptor-like protein kinase At1g67000 isoform X2 [Cucumis melo]) HSP 1 Score: 101.3 bits (251), Expect = 8.4e-19 Identity = 47/62 (75.81%), Postives = 55/62 (88.71%), Query Frame = 2
BLAST of CU166418 vs. NCBI nr
Match: gi|659066762|ref|XP_008460163.1| (PREDICTED: probable receptor-like protein kinase At1g67000 isoform X1 [Cucumis melo]) HSP 1 Score: 99.4 bits (246), Expect = 3.2e-18 Identity = 48/67 (71.64%), Postives = 56/67 (83.58%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|