CU166375 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AACGGGCGGCGGAGGATCTCACTGCCAAGAACAAGAAGCTCCTCCTCTGTGGCGAACAAAGGCCATTTTGTAGTCTACACGGTGGACCAAAAACGGTGCGTTTTGCCCATAAGGTATTTGGGAAACTATGTTTTAAAGGAGTTGTTGAAGATGTCGGAGGAGGAGTTTGGGTTGCCGTGCGGATGGACCGATAAAGCTGCCGTGTGAGGCGGCGTTTATGGAGTATATCGTGTATTTG
BLAST of CU166375 vs. Swiss-Prot
Match: SAU68_ARATH (Auxin-responsive protein SAUR68 OS=Arabidopsis thaliana GN=SAUR68 PE=3 SV=1) HSP 1 Score: 68.9 bits (167), Expect = 2.8e-11 Identity = 37/60 (61.67%), Postives = 40/60 (66.67%), Query Frame = 1
BLAST of CU166375 vs. Swiss-Prot
Match: SAU64_ARATH (Auxin-responsive protein SAUR64 OS=Arabidopsis thaliana GN=SAUR64 PE=2 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 6.1e-11 Identity = 36/61 (59.02%), Postives = 41/61 (67.21%), Query Frame = 1
BLAST of CU166375 vs. Swiss-Prot
Match: SAU61_ARATH (Auxin-responsive protein SAUR61 OS=Arabidopsis thaliana GN=SAUR61 PE=2 SV=1) HSP 1 Score: 66.2 bits (160), Expect = 1.8e-10 Identity = 36/60 (60.00%), Postives = 42/60 (70.00%), Query Frame = 1
BLAST of CU166375 vs. Swiss-Prot
Match: SAU67_ARATH (Auxin-responsive protein SAUR67 OS=Arabidopsis thaliana GN=SAUR67 PE=2 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 2.3e-10 Identity = 35/60 (58.33%), Postives = 40/60 (66.67%), Query Frame = 1
BLAST of CU166375 vs. Swiss-Prot
Match: SAU66_ARATH (Auxin-responsive protein SAUR66 OS=Arabidopsis thaliana GN=SAUR66 PE=2 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 2.3e-10 Identity = 32/59 (54.24%), Postives = 37/59 (62.71%), Query Frame = 1
BLAST of CU166375 vs. TrEMBL
Match: A0A0A0K2P5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G018810 PE=4 SV=1) HSP 1 Score: 120.9 bits (302), Expect = 6.8e-25 Identity = 59/59 (100.00%), Postives = 59/59 (100.00%), Query Frame = 1
BLAST of CU166375 vs. TrEMBL
Match: A0A0A0K2P5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G018810 PE=4 SV=1) HSP 1 Score: 47.0 bits (110), Expect = 1.2e-02 Identity = 21/23 (91.30%), Postives = 21/23 (91.30%), Query Frame = 2
HSP 2 Score: 81.3 bits (199), Expect = 6.0e-13 Identity = 41/68 (60.29%), Postives = 47/68 (69.12%), Query Frame = 1
BLAST of CU166375 vs. TrEMBL
Match: A0A061E5H5_THECC (SAUR-like auxin-responsive protein family, putative OS=Theobroma cacao GN=TCM_006523 PE=4 SV=1) HSP 1 Score: 37.0 bits (84), Expect = 1.3e+01 Identity = 16/23 (69.57%), Postives = 18/23 (78.26%), Query Frame = 2
HSP 2 Score: 80.5 bits (197), Expect = 1.0e-12 Identity = 40/67 (59.70%), Postives = 48/67 (71.64%), Query Frame = 1
BLAST of CU166375 vs. TrEMBL
Match: K4D5X8_SOLLC (Uncharacterized protein OS=Solanum lycopersicum PE=4 SV=1) HSP 1 Score: 33.1 bits (74), Expect = 1.9e+02 Identity = 13/23 (56.52%), Postives = 17/23 (73.91%), Query Frame = 2
HSP 2 Score: 80.1 bits (196), Expect = 1.3e-12 Identity = 41/66 (62.12%), Postives = 49/66 (74.24%), Query Frame = 1
BLAST of CU166375 vs. TrEMBL
Match: M1B7J0_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400015029 PE=4 SV=1) HSP 1 Score: 30.4 bits (67), Expect = 1.2e+03 Identity = 12/17 (70.59%), Postives = 15/17 (88.24%), Query Frame = 2
HSP 2 Score: 77.8 bits (190), Expect = 6.6e-12 Identity = 40/59 (67.80%), Postives = 45/59 (76.27%), Query Frame = 1
BLAST of CU166375 vs. NCBI nr
Match: gi|700188066|gb|KGN43299.1| (hypothetical protein Csa_7G018810 [Cucumis sativus]) HSP 1 Score: 120.9 bits (302), Expect = 9.8e-25 Identity = 59/59 (100.00%), Postives = 59/59 (100.00%), Query Frame = 1
BLAST of CU166375 vs. NCBI nr
Match: gi|778723154|ref|XP_004144931.2| (PREDICTED: auxin-induced protein 6B-like [Cucumis sativus]) HSP 1 Score: 120.9 bits (302), Expect = 9.8e-25 Identity = 59/59 (100.00%), Postives = 59/59 (100.00%), Query Frame = 1
BLAST of CU166375 vs. NCBI nr
Match: gi|590683862|ref|XP_007041697.1| (SAUR-like auxin-responsive protein family, putative [Theobroma cacao]) HSP 1 Score: 81.3 bits (199), Expect = 8.6e-13 Identity = 41/68 (60.29%), Postives = 47/68 (69.12%), Query Frame = 1
BLAST of CU166375 vs. NCBI nr
Match: gi|698543404|ref|XP_009766731.1| (PREDICTED: auxin-induced protein 6B-like [Nicotiana sylvestris]) HSP 1 Score: 80.9 bits (198), Expect = 1.1e-12 Identity = 41/67 (61.19%), Postives = 50/67 (74.63%), Query Frame = 1
BLAST of CU166375 vs. NCBI nr
Match: gi|460409602|ref|XP_004250227.1| (PREDICTED: auxin-induced protein 6B-like [Solanum lycopersicum]) HSP 1 Score: 80.5 bits (197), Expect = 1.5e-12 Identity = 40/67 (59.70%), Postives = 48/67 (71.64%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|