CU166335 (transcribed_cluster) Cucumber (Chinese Long) v2 | Cucurbit Genomics Database (CuGenDB)


Name	CU166335
Type	transcribed_cluster
Organism	Cucumis. sativus (Cucumber (Chinese Long) v2)
Description	Plant invertase/pectin methylesterase inhibitor superfamily
Location	Chr7 : 12496112 .. 12496225 (-)
Sequence length	115

The following sequences are available for this feature:

GATGGTTTTTTAGTCTCGAGACATAACCTTTCAAAACAAAGACCGGAGCAGCCAACGGCCAAGCTGTAGCTCTCCGTGTTGGCTCAGATCACTCGGCCTTCTACCGATGTAGCAT


Library category	ESTs
hermaphrodite flower library	1

The following BLAST results are available for this feature:


Match Name	E-value	Identity	Description

This transcribed_cluster is associated with the following gene feature(s):


Feature Name	Unique Name	Type
Csa7G343870	Csa7G343870	gene

The following EST feature(s) are a part of this transcribed_cluster:


Feature Name	Unique Name	Type
H0100782	H0100782	EST