CU166252 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ATGCTTAGCTTTGATATCTGATAAAATCCAACAGAGTTTAACATGAGGCTGAAGTTCATGGCTGCTATCGACGTGTTGGCGATAATGGAGAACCAAAGAAGCTCCCAAAAGGGAACCGACTTGGATTCAGAATAGCCAGCGGCATTTGAAATCCAACCAATTAATGCAGTGACAGAAAAGTGAAATCCAGTTAAAGTTGTAGCAAAAGGAAAATGCAAAAGCCAGTTTGAGACATGAGTTGCTTATTA
BLAST of CU166252 vs. Swiss-Prot
Match: UGAL2_ARATH (UDP-galactose transporter 2 OS=Arabidopsis thaliana GN=UDP-GALT2 PE=2 SV=1) HSP 1 Score: 117.9 bits (294), Expect = 5.4e-26 Identity = 57/70 (81.43%), Postives = 59/70 (84.29%), Query Frame = -1
BLAST of CU166252 vs. TrEMBL
Match: A0A0A0KCR4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G115640 PE=4 SV=1) HSP 1 Score: 140.6 bits (353), Expect = 8.6e-31 Identity = 69/70 (98.57%), Postives = 69/70 (98.57%), Query Frame = -1
BLAST of CU166252 vs. TrEMBL
Match: C4J9D3_MAIZE (Uncharacterized protein OS=Zea mays GN=LOC100384530 PE=2 SV=1) HSP 1 Score: 122.9 bits (307), Expect = 1.9e-25 Identity = 57/70 (81.43%), Postives = 62/70 (88.57%), Query Frame = -1
BLAST of CU166252 vs. TrEMBL
Match: J3MME3_ORYBR (Uncharacterized protein OS=Oryza brachyantha PE=4 SV=1) HSP 1 Score: 122.9 bits (307), Expect = 1.9e-25 Identity = 57/70 (81.43%), Postives = 62/70 (88.57%), Query Frame = -1
BLAST of CU166252 vs. TrEMBL
Match: A0A0E0LMN5_ORYPU (Uncharacterized protein OS=Oryza punctata PE=4 SV=1) HSP 1 Score: 122.9 bits (307), Expect = 1.9e-25 Identity = 57/70 (81.43%), Postives = 62/70 (88.57%), Query Frame = -1
BLAST of CU166252 vs. TrEMBL
Match: A0A0D3GST7_9ORYZ (Uncharacterized protein OS=Oryza barthii PE=4 SV=1) HSP 1 Score: 122.9 bits (307), Expect = 1.9e-25 Identity = 57/70 (81.43%), Postives = 62/70 (88.57%), Query Frame = -1
BLAST of CU166252 vs. NCBI nr
Match: gi|449444447|ref|XP_004139986.1| (PREDICTED: UDP-galactose transporter 2-like [Cucumis sativus]) HSP 1 Score: 137.9 bits (346), Expect = 8.0e-30 Identity = 69/70 (98.57%), Postives = 69/70 (98.57%), Query Frame = -1
BLAST of CU166252 vs. NCBI nr
Match: gi|659094600|ref|XP_008448146.1| (PREDICTED: UDP-galactose transporter 2-like [Cucumis melo]) HSP 1 Score: 136.3 bits (342), Expect = 2.3e-29 Identity = 68/70 (97.14%), Postives = 68/70 (97.14%), Query Frame = -1
BLAST of CU166252 vs. NCBI nr
Match: gi|470128258|ref|XP_004300063.1| (PREDICTED: UDP-galactose transporter 2-like [Fragaria vesca subsp. vesca]) HSP 1 Score: 123.2 bits (308), Expect = 2.0e-25 Identity = 59/70 (84.29%), Postives = 65/70 (92.86%), Query Frame = -1
BLAST of CU166252 vs. NCBI nr
Match: gi|1002286378|ref|XP_015647494.1| (PREDICTED: UDP-galactose transporter 2 [Oryza sativa Japonica Group]) HSP 1 Score: 120.2 bits (300), Expect = 1.7e-24 Identity = 57/70 (81.43%), Postives = 62/70 (88.57%), Query Frame = -1
BLAST of CU166252 vs. NCBI nr
Match: gi|219887815|gb|ACL54282.1| (unknown [Zea mays]) HSP 1 Score: 120.2 bits (300), Expect = 1.7e-24 Identity = 57/70 (81.43%), Postives = 62/70 (88.57%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|