CU165969 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGATCTCAGAATCAATGGCCACAAAGATCGACGGAATCGAAGATGAAGAAATTTCAAAGCTTGAAGAAGGCATTGTCGTTTCCGCCGTTGCTCGTTTCTGTCCCTCCAATTTAGTCGTCATCATCCAAAAGGTAATCGCGGAGTTGATCGGGACGTACTTCGTGATCTTCGGGGGATGTGGGGCGGTGGTGGTGAACAAAATATACGGATCAGTGACATTTCCGGGAAT
BLAST of CU165969 vs. Swiss-Prot
Match: NIP1_NICAL (Probable aquaporin NIP-type OS=Nicotiana alata PE=2 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 9.3e-17 Identity = 47/74 (63.51%), Postives = 55/74 (74.32%), Query Frame = 3
BLAST of CU165969 vs. Swiss-Prot
Match: NIP41_ARATH (Putative aquaporin NIP4-1 OS=Arabidopsis thaliana GN=NIP4-1 PE=3 SV=1) HSP 1 Score: 68.6 bits (166), Expect = 3.4e-11 Identity = 37/78 (47.44%), Postives = 52/78 (66.67%), Query Frame = 3
BLAST of CU165969 vs. Swiss-Prot
Match: NIP42_ARATH (Probable aquaporin NIP4-2 OS=Arabidopsis thaliana GN=NIP4-2 PE=2 SV=2) HSP 1 Score: 68.6 bits (166), Expect = 3.4e-11 Identity = 37/77 (48.05%), Postives = 51/77 (66.23%), Query Frame = 3
BLAST of CU165969 vs. Swiss-Prot
Match: NIP11_ORYSJ (Aquaporin NIP1-1 OS=Oryza sativa subsp. japonica GN=NIP1-1 PE=2 SV=1) HSP 1 Score: 52.8 bits (125), Expect = 1.9e-06 Identity = 24/39 (61.54%), Postives = 28/39 (71.79%), Query Frame = 3
BLAST of CU165969 vs. Swiss-Prot
Match: NIP11_MAIZE (Aquaporin NIP1-1 OS=Zea mays GN=NIP1-1 PE=2 SV=1) HSP 1 Score: 52.8 bits (125), Expect = 1.9e-06 Identity = 28/59 (47.46%), Postives = 36/59 (61.02%), Query Frame = 3
BLAST of CU165969 vs. TrEMBL
Match: A0A0A0LA39_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G345890 PE=3 SV=1) HSP 1 Score: 141.0 bits (354), Expect = 6.0e-31 Identity = 71/71 (100.00%), Postives = 71/71 (100.00%), Query Frame = 3
BLAST of CU165969 vs. TrEMBL
Match: A0A151U148_CAJCA (Putative aquaporin NIP-type OS=Cajanus cajan GN=KK1_005646 PE=3 SV=1) HSP 1 Score: 95.5 bits (236), Expect = 2.9e-17 Identity = 45/76 (59.21%), Postives = 59/76 (77.63%), Query Frame = 3
BLAST of CU165969 vs. TrEMBL
Match: K7KAK5_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_02G246700 PE=3 SV=1) HSP 1 Score: 91.3 bits (225), Expect = 5.5e-16 Identity = 44/77 (57.14%), Postives = 58/77 (75.32%), Query Frame = 3
BLAST of CU165969 vs. TrEMBL
Match: A0A0B2S9W2_GLYSO (Putative aquaporin NIP-type OS=Glycine soja GN=glysoja_013426 PE=3 SV=1) HSP 1 Score: 91.3 bits (225), Expect = 5.5e-16 Identity = 44/77 (57.14%), Postives = 58/77 (75.32%), Query Frame = 3
BLAST of CU165969 vs. TrEMBL
Match: A0A061EGH1_THECC (NOD26-like intrinsic protein 4,1 OS=Theobroma cacao GN=TCM_019213 PE=3 SV=1) HSP 1 Score: 89.4 bits (220), Expect = 2.1e-15 Identity = 48/78 (61.54%), Postives = 57/78 (73.08%), Query Frame = 3
BLAST of CU165969 vs. NCBI nr
Match: gi|449464154|ref|XP_004149794.1| (PREDICTED: probable aquaporin NIP-type [Cucumis sativus]) HSP 1 Score: 136.7 bits (343), Expect = 1.6e-29 Identity = 71/71 (100.00%), Postives = 71/71 (100.00%), Query Frame = 3
BLAST of CU165969 vs. NCBI nr
Match: gi|659114474|ref|XP_008457069.1| (PREDICTED: probable aquaporin NIP-type [Cucumis melo]) HSP 1 Score: 125.9 bits (315), Expect = 2.9e-26 Identity = 65/71 (91.55%), Postives = 66/71 (92.96%), Query Frame = 3
BLAST of CU165969 vs. NCBI nr
Match: gi|1012361856|gb|KYP73039.1| (putative aquaporin NIP-type [Cajanus cajan]) HSP 1 Score: 91.3 bits (225), Expect = 7.9e-16 Identity = 45/76 (59.21%), Postives = 59/76 (77.63%), Query Frame = 3
BLAST of CU165969 vs. NCBI nr
Match: gi|356499099|ref|XP_003518381.1| (PREDICTED: probable aquaporin NIP-type [Glycine max]) HSP 1 Score: 87.0 bits (214), Expect = 1.5e-14 Identity = 44/77 (57.14%), Postives = 58/77 (75.32%), Query Frame = 3
BLAST of CU165969 vs. NCBI nr
Match: gi|590652058|ref|XP_007033055.1| (NOD26-like intrinsic protein 4,1 [Theobroma cacao]) HSP 1 Score: 85.1 bits (209), Expect = 5.6e-14 Identity = 48/78 (61.54%), Postives = 57/78 (73.08%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|