CU165712 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGCAATGCGACCACACCTCCAGTGGGCTTGAAGTCCAAACTGCTCTCCAAAAACTTGAAGCCCAATACTTTTCTGCACGAACAACAAAATCCTTCCAACCCATTGGAGACCACCACCCGACGACCTTGCTATTCTATCTGGATAAGTATCAAGGATGTGTGGGATCTTTATTTTGAGAAGGGAAGAGATTTTTGTAGAGACTTTTTGCAAAGCTCTGGACAAGTATAAAGGATGTGAGGGATCTTTATTGGAAATGGAAGACTATTTTTTCGTA
BLAST of CU165712 vs. TrEMBL
Match: A0A0A0M0P4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G660710 PE=4 SV=1) HSP 1 Score: 82.4 bits (202), Expect = 3.1e-13 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = -1
BLAST of CU165712 vs. NCBI nr
Match: gi|700211606|gb|KGN66702.1| (hypothetical protein Csa_1G660710 [Cucumis sativus]) HSP 1 Score: 82.4 bits (202), Expect = 4.4e-13 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|