CU164877 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GACCATTATTATTATTCCCATCCTAAGAAACCTCTCTCTCTTTTTCTCTCTCTCTGGTAACACACATGGCCACTGGCCAACTTAGGAAGCTTATAGTTGAAGTTGTGGATGCTCGTAACCTCTTGCCTAAAGATGGACATGGATCCTCCAGTCCTTACATCGTGGTCGACTACTATGGCCAACGAAAAACGGACACGAACCATAGTGCATGACTTGAACCCG
BLAST of CU164877 vs. Swiss-Prot
Match: QKY_ARATH (Protein QUIRKY OS=Arabidopsis thaliana GN=QKY PE=2 SV=1) HSP 1 Score: 57.0 bits (136), Expect = 1.0e-07 Identity = 27/46 (58.70%), Postives = 32/46 (69.57%), Query Frame = 3
BLAST of CU164877 vs. TrEMBL
Match: A0A0A0KWC9_CUCSA (Phosphoribosylanthranilate transferase-like protein OS=Cucumis sativus GN=Csa_4G188990 PE=4 SV=1) HSP 1 Score: 85.5 bits (210), Expect = 2.9e-14 Identity = 41/41 (100.00%), Postives = 41/41 (100.00%), Query Frame = 3
BLAST of CU164877 vs. TrEMBL
Match: A0A0A0KWC9_CUCSA (Phosphoribosylanthranilate transferase-like protein OS=Cucumis sativus GN=Csa_4G188990 PE=4 SV=1) HSP 1 Score: 29.3 bits (64), Expect = 2.5e+03 Identity = 12/12 (100.00%), Postives = 12/12 (100.00%), Query Frame = 1
HSP 2 Score: 72.0 bits (175), Expect = 3.3e-10 Identity = 35/41 (85.37%), Postives = 39/41 (95.12%), Query Frame = 3
BLAST of CU164877 vs. TrEMBL
Match: B9I5V8_POPTR (C2 domain-containing family protein OS=Populus trichocarpa GN=POPTR_0013s05220g PE=4 SV=2) HSP 1 Score: 71.6 bits (174), Expect = 4.4e-10 Identity = 32/38 (84.21%), Postives = 36/38 (94.74%), Query Frame = 3
BLAST of CU164877 vs. TrEMBL
Match: A0A0J8CBW6_BETVU (Uncharacterized protein OS=Beta vulgaris subsp. vulgaris GN=BVRB_5g110060 PE=4 SV=1) HSP 1 Score: 70.9 bits (172), Expect = 7.5e-10 Identity = 34/41 (82.93%), Postives = 39/41 (95.12%), Query Frame = 3
BLAST of CU164877 vs. TrEMBL
Match: A0A067EUT5_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g001521mg PE=4 SV=1) HSP 1 Score: 70.5 bits (171), Expect = 9.7e-10 Identity = 30/36 (83.33%), Postives = 36/36 (100.00%), Query Frame = 3
BLAST of CU164877 vs. NCBI nr
Match: gi|449462788|ref|XP_004149122.1| (PREDICTED: multiple C2 and transmembrane domain-containing protein 2 [Cucumis sativus]) HSP 1 Score: 87.4 bits (215), Expect = 1.1e-14 Identity = 41/41 (100.00%), Postives = 41/41 (100.00%), Query Frame = 3
BLAST of CU164877 vs. NCBI nr
Match: gi|659082715|ref|XP_008441994.1| (PREDICTED: multiple C2 and transmembrane domain-containing protein 2 [Cucumis melo]) HSP 1 Score: 87.0 bits (214), Expect = 1.4e-14 Identity = 40/41 (97.56%), Postives = 41/41 (100.00%), Query Frame = 3
BLAST of CU164877 vs. NCBI nr
Match: gi|902164157|gb|KNA06939.1| (hypothetical protein SOVF_176470 [Spinacia oleracea]) HSP 1 Score: 73.9 bits (180), Expect = 1.3e-10 Identity = 35/41 (85.37%), Postives = 39/41 (95.12%), Query Frame = 3
BLAST of CU164877 vs. NCBI nr
Match: gi|1012264547|ref|XP_015947010.1| (PREDICTED: protein QUIRKY [Arachis duranensis]) HSP 1 Score: 73.9 bits (180), Expect = 1.3e-10 Identity = 31/38 (81.58%), Postives = 37/38 (97.37%), Query Frame = 3
BLAST of CU164877 vs. NCBI nr
Match: gi|1021583841|ref|XP_016181298.1| (PREDICTED: protein QUIRKY [Arachis ipaensis]) HSP 1 Score: 73.9 bits (180), Expect = 1.3e-10 Identity = 31/38 (81.58%), Postives = 37/38 (97.37%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|