CU164851 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGAAAACTTGGTGATGATGACTATGGTCAGGCCATGTTGTATTATATGAATGTGAATAATGTTCAGACTCGATCAGTTCGGGTTGACAGTAAGCGGACAACAGCTGTGTCACATATGAAAATTGGCAAGAGGGGTCGCTTGAAAATGACTTGTGTTAAATCTAGTGCAGAAGATTATTTATCAAAGTCAGAGATCAACATAGATGTGTTAAAGGAGGCTAAAATGTTCTACTTT
BLAST of CU164851 vs. Swiss-Prot
Match: SCKL2_ARATH (Fructokinase-like 2, chloroplastic OS=Arabidopsis thaliana GN=FLN2 PE=1 SV=2) HSP 1 Score: 124.4 bits (311), Expect = 5.5e-28 Identity = 61/78 (78.21%), Postives = 64/78 (82.05%), Query Frame = 1
BLAST of CU164851 vs. Swiss-Prot
Match: SCKL1_ARATH (Fructokinase-like 1, chloroplastic OS=Arabidopsis thaliana GN=FLN1 PE=1 SV=1) HSP 1 Score: 68.6 bits (166), Expect = 3.6e-11 Identity = 35/79 (44.30%), Postives = 49/79 (62.03%), Query Frame = 1
BLAST of CU164851 vs. Swiss-Prot
Match: SCRK5_ARATH (Probable fructokinase-5 OS=Arabidopsis thaliana GN=At4g10260 PE=2 SV=1) HSP 1 Score: 51.2 bits (121), Expect = 5.9e-06 Identity = 25/79 (31.65%), Postives = 45/79 (56.96%), Query Frame = 1
BLAST of CU164851 vs. TrEMBL
Match: A0A0A0L422_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G571770 PE=4 SV=1) HSP 1 Score: 157.9 bits (398), Expect = 5.0e-36 Identity = 78/78 (100.00%), Postives = 78/78 (100.00%), Query Frame = 1
BLAST of CU164851 vs. TrEMBL
Match: V4STJ9_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10031077mg PE=4 SV=1) HSP 1 Score: 139.8 bits (351), Expect = 1.4e-30 Identity = 68/78 (87.18%), Postives = 73/78 (93.59%), Query Frame = 1
BLAST of CU164851 vs. TrEMBL
Match: A0A067G4G1_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g0081612mg PE=4 SV=1) HSP 1 Score: 139.8 bits (351), Expect = 1.4e-30 Identity = 68/78 (87.18%), Postives = 73/78 (93.59%), Query Frame = 1
BLAST of CU164851 vs. TrEMBL
Match: A0A067G3Q1_CITSI (Uncharacterized protein (Fragment) OS=Citrus sinensis GN=CISIN_1g0081612mg PE=4 SV=1) HSP 1 Score: 139.8 bits (351), Expect = 1.4e-30 Identity = 68/78 (87.18%), Postives = 73/78 (93.59%), Query Frame = 1
BLAST of CU164851 vs. TrEMBL
Match: M5XDX2_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa003690mg PE=4 SV=1) HSP 1 Score: 139.0 bits (349), Expect = 2.4e-30 Identity = 68/78 (87.18%), Postives = 72/78 (92.31%), Query Frame = 1
BLAST of CU164851 vs. NCBI nr
Match: gi|778695160|ref|XP_004144690.2| (PREDICTED: fructokinase-like 2, chloroplastic [Cucumis sativus]) HSP 1 Score: 156.0 bits (393), Expect = 2.7e-35 Identity = 78/78 (100.00%), Postives = 78/78 (100.00%), Query Frame = 1
BLAST of CU164851 vs. NCBI nr
Match: gi|659083217|ref|XP_008442238.1| (PREDICTED: uncharacterized protein LOC103486152 [Cucumis melo]) HSP 1 Score: 147.9 bits (372), Expect = 7.4e-33 Identity = 75/78 (96.15%), Postives = 76/78 (97.44%), Query Frame = 1
BLAST of CU164851 vs. NCBI nr
Match: gi|641851450|gb|KDO70321.1| (hypothetical protein CISIN_1g0081612mg [Citrus sinensis]) HSP 1 Score: 137.9 bits (346), Expect = 7.6e-30 Identity = 68/78 (87.18%), Postives = 73/78 (93.59%), Query Frame = 1
BLAST of CU164851 vs. NCBI nr
Match: gi|567890745|ref|XP_006437893.1| (hypothetical protein CICLE_v10031077mg [Citrus clementina]) HSP 1 Score: 137.9 bits (346), Expect = 7.6e-30 Identity = 68/78 (87.18%), Postives = 73/78 (93.59%), Query Frame = 1
BLAST of CU164851 vs. NCBI nr
Match: gi|641851451|gb|KDO70322.1| (hypothetical protein CISIN_1g0081612mg, partial [Citrus sinensis]) HSP 1 Score: 137.9 bits (346), Expect = 7.6e-30 Identity = 68/78 (87.18%), Postives = 73/78 (93.59%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|