CU164221 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GATTATGTCATTTCCCTGTAAATTGATTATTTTGCATCGTTTGAACTAAGAACTAAAGACACTAGGTGGTGCTGGTTTGAAAATTTTGTCATCTTCATTATATTCCTTGATTTCGGACATGGGTGCAGTGATATCTAGGTTGAGGAAGAGACTTTTTCAGAACCGTGAAGTGAGAATCCTGATGCTCGGTCTTGATGCGTCAGGGAAGACAAC
BLAST of CU164221 vs. TrEMBL
Match: A0A0A0K7V4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G072830 PE=3 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 4.3e-07 Identity = 31/31 (100.00%), Postives = 31/31 (100.00%), Query Frame = 2
BLAST of CU164221 vs. NCBI nr
Match: gi|778730201|ref|XP_011659724.1| (PREDICTED: ADP-ribosylation factor 1-like [Cucumis sativus]) HSP 1 Score: 68.9 bits (167), Expect = 3.9e-09 Identity = 39/54 (72.22%), Postives = 39/54 (72.22%), Query Frame = 2
BLAST of CU164221 vs. NCBI nr
Match: gi|659081062|ref|XP_008441130.1| (PREDICTED: uncharacterized protein LOC103485359 [Cucumis melo]) HSP 1 Score: 66.2 bits (160), Expect = 2.5e-08 Identity = 35/49 (71.43%), Postives = 35/49 (71.43%), Query Frame = 2
BLAST of CU164221 vs. NCBI nr
Match: gi|700188663|gb|KGN43896.1| (hypothetical protein Csa_7G072830 [Cucumis sativus]) HSP 1 Score: 61.6 bits (148), Expect = 6.2e-07 Identity = 31/31 (100.00%), Postives = 31/31 (100.00%), Query Frame = 2
BLAST of CU164221 vs. NCBI nr
Match: gi|659109994|ref|XP_008454992.1| (PREDICTED: ADP-ribosylation factor 1-like [Cucumis melo]) HSP 1 Score: 59.3 bits (142), Expect = 3.1e-06 Identity = 30/31 (96.77%), Postives = 30/31 (96.77%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|