CU163789 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ACCTTTTGGAGCTTCTCATTCAATTCAATGTCACCGCAGACAATCTTCTCGTCCCTCAGGATGTCGAGGATCAACAGCATCAAGAACTTCTTTCAGAACTTCTAATGCATTGCCAGCCTTTTCAATTATACTAGATTCTGATAATATCTGAGGTTCCACTCTAGCAACATTCTCCTGCTCAGATAATCTTATTACTCCATTTTGTGAAGTATTATTAATTTGCTGCTGGGTAGACTT
BLAST of CU163789 vs. TrEMBL
Match: A0A068VD20_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00009831001 PE=4 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 2.6e-08 Identity = 31/45 (68.89%), Postives = 40/45 (88.89%), Query Frame = -1
BLAST of CU163789 vs. TrEMBL
Match: W9RQ74_9ROSA (TOM1-like protein 2 OS=Morus notabilis GN=L484_013104 PE=4 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 1.3e-07 Identity = 34/53 (64.15%), Postives = 39/53 (73.58%), Query Frame = -1
BLAST of CU163789 vs. TrEMBL
Match: A0A166ETT0_DAUCA (Uncharacterized protein OS=Daucus carota subsp. sativus GN=DCAR_007809 PE=4 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 6.4e-07 Identity = 29/46 (63.04%), Postives = 38/46 (82.61%), Query Frame = -1
BLAST of CU163789 vs. TrEMBL
Match: U5FGV1_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0019s00820g PE=4 SV=1) HSP 1 Score: 60.8 bits (146), Expect = 8.4e-07 Identity = 29/39 (74.36%), Postives = 35/39 (89.74%), Query Frame = -1
BLAST of CU163789 vs. TrEMBL
Match: B9IP43_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0019s00820g PE=4 SV=2) HSP 1 Score: 60.8 bits (146), Expect = 8.4e-07 Identity = 29/39 (74.36%), Postives = 35/39 (89.74%), Query Frame = -1
BLAST of CU163789 vs. NCBI nr
Match: gi|778694136|ref|XP_011653749.1| (PREDICTED: target of Myb protein 1 isoform X2 [Cucumis sativus]) HSP 1 Score: 97.8 bits (242), Expect = 8.9e-18 Identity = 50/52 (96.15%), Postives = 50/52 (96.15%), Query Frame = -1
BLAST of CU163789 vs. NCBI nr
Match: gi|449449813|ref|XP_004142659.1| (PREDICTED: target of Myb protein 1 isoform X1 [Cucumis sativus]) HSP 1 Score: 97.8 bits (242), Expect = 8.9e-18 Identity = 50/52 (96.15%), Postives = 50/52 (96.15%), Query Frame = -1
BLAST of CU163789 vs. NCBI nr
Match: gi|659069348|ref|XP_008449359.1| (PREDICTED: LOW QUALITY PROTEIN: TOM1-like protein 1 [Cucumis melo]) HSP 1 Score: 94.0 bits (232), Expect = 1.3e-16 Identity = 47/52 (90.38%), Postives = 49/52 (94.23%), Query Frame = -1
BLAST of CU163789 vs. NCBI nr
Match: gi|700199333|gb|KGN54491.1| (hypothetical protein Csa_4G338950 [Cucumis sativus]) HSP 1 Score: 93.6 bits (231), Expect = 1.7e-16 Identity = 48/48 (100.00%), Postives = 48/48 (100.00%), Query Frame = -1
BLAST of CU163789 vs. NCBI nr
Match: gi|661877477|emb|CDP18690.1| (unnamed protein product [Coffea canephora]) HSP 1 Score: 65.5 bits (158), Expect = 4.9e-08 Identity = 31/45 (68.89%), Postives = 40/45 (88.89%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|