CU163549 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AAGGTACAACACCTGCCCAATAACTCCAGTTCTTCCCAGAAGAGTCGAGGATACATAGTAGAACCCCTTTTTCACGTAACGTAGGCTCGTAGTGAGCAATCATTCCCAAGCTGAAACACCCATCACTGGCAATGTCCTGATGACATGACAGTCGCTTGGAAAGTGTCTGATAATTGCCTCTCCGTAGTTCATACAGAGGGAGACTGCTGGGACAACCATCAGGTTTCACCCA
BLAST of CU163549 vs. TrEMBL
Match: A0A0A0L7N0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G126760 PE=4 SV=1) HSP 1 Score: 125.6 bits (314), Expect = 2.7e-26 Identity = 57/57 (100.00%), Postives = 57/57 (100.00%), Query Frame = -1
BLAST of CU163549 vs. TrEMBL
Match: A0A0V0IML3_SOLCH (Putative nitroreductase family protein-like OS=Solanum chacoense PE=4 SV=1) HSP 1 Score: 103.6 bits (257), Expect = 1.1e-19 Identity = 46/56 (82.14%), Postives = 49/56 (87.50%), Query Frame = -1
BLAST of CU163549 vs. TrEMBL
Match: K4AZ53_SOLLC (Uncharacterized protein OS=Solanum lycopersicum PE=4 SV=1) HSP 1 Score: 103.6 bits (257), Expect = 1.1e-19 Identity = 46/56 (82.14%), Postives = 49/56 (87.50%), Query Frame = -1
BLAST of CU163549 vs. TrEMBL
Match: M1CG62_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400025962 PE=4 SV=1) HSP 1 Score: 103.6 bits (257), Expect = 1.1e-19 Identity = 46/56 (82.14%), Postives = 49/56 (87.50%), Query Frame = -1
BLAST of CU163549 vs. TrEMBL
Match: A0A067KAE5_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_14545 PE=4 SV=1) HSP 1 Score: 102.1 bits (253), Expect = 3.2e-19 Identity = 43/57 (75.44%), Postives = 51/57 (89.47%), Query Frame = -1
BLAST of CU163549 vs. NCBI nr
Match: gi|778677468|ref|XP_011650794.1| (PREDICTED: uncharacterized protein LOC101216535 [Cucumis sativus]) HSP 1 Score: 129.8 bits (325), Expect = 2.0e-27 Identity = 57/57 (100.00%), Postives = 57/57 (100.00%), Query Frame = -1
BLAST of CU163549 vs. NCBI nr
Match: gi|659075504|ref|XP_008438181.1| (PREDICTED: uncharacterized protein LOC103483366 [Cucumis melo]) HSP 1 Score: 127.5 bits (319), Expect = 1.0e-26 Identity = 56/57 (98.25%), Postives = 56/57 (98.25%), Query Frame = -1
BLAST of CU163549 vs. NCBI nr
Match: gi|698548207|ref|XP_009768266.1| (PREDICTED: uncharacterized protein LOC104219300 [Nicotiana sylvestris]) HSP 1 Score: 109.8 bits (273), Expect = 2.2e-21 Identity = 47/56 (83.93%), Postives = 49/56 (87.50%), Query Frame = -1
BLAST of CU163549 vs. NCBI nr
Match: gi|697148983|ref|XP_009628686.1| (PREDICTED: uncharacterized protein LOC104119003 [Nicotiana tomentosiformis]) HSP 1 Score: 109.0 bits (271), Expect = 3.7e-21 Identity = 46/56 (82.14%), Postives = 50/56 (89.29%), Query Frame = -1
BLAST of CU163549 vs. NCBI nr
Match: gi|969995615|ref|XP_015072120.1| (PREDICTED: uncharacterized protein LOC107016116 [Solanum pennellii]) HSP 1 Score: 107.8 bits (268), Expect = 8.3e-21 Identity = 46/56 (82.14%), Postives = 49/56 (87.50%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|