CU163478 (transcribed_cluster) Cucumber (Chinese Long) v2 | Cucurbit Genomics Database (CuGenDB)


Name	CU163478
Type	transcribed_cluster
Organism	Cucumis. sativus (Cucumber (Chinese Long) v2)
Description	No hit
Location	Chr3 : 8573713 .. 8573815 (-)
Sequence length	108

The following sequences are available for this feature:

ATTCCCCAAAAGGATATTAATTGCACCTTTCTATTGTTTAAATGGAGAAAAAGAAAAACCATAATTATATCGATGAATTAATAACATAGGATTAAGATAGGAAAGAAA


Library category	ESTs
hermaphrodite flower library	1

The following BLAST results are available for this feature:


Match Name	E-value	Identity	Description

This transcribed_cluster is associated with the following gene feature(s):


Feature Name	Unique Name	Type
Csa3G131980	Csa3G131980	gene

The following EST feature(s) are a part of this transcribed_cluster:


Feature Name	Unique Name	Type
H0073000	H0073000	EST