CU163435 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGTTCAAGAATGGGGAGAAATGTGATAGCGTGATAGGGACAATGCCAAAGGATTTCTATATTGCTGCCGTTGAAAGGGTCCTGAAGCAGTAGGAGACATGAGCAATCGAATAGGATATCTTTGGTAAGGTTGACCAGCTTGATTGTGCGAGTTGGTTGGCCATTTTGTTGCCAAAGCTTTCCACTGGTTTACTAGTTCTTGAGTGTATATAATAAATTAGCTTTTAA
BLAST of CU163435 vs. TrEMBL
Match: A0A0A0K2M6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G073610 PE=4 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 2.1e-07 Identity = 29/29 (100.00%), Postives = 29/29 (100.00%), Query Frame = 3
BLAST of CU163435 vs. TrEMBL
Match: C6T0F3_SOYBN (Putative uncharacterized protein OS=Glycine max PE=2 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 3.9e-06 Identity = 25/28 (89.29%), Postives = 28/28 (100.00%), Query Frame = 3
BLAST of CU163435 vs. TrEMBL
Match: A0A0R0J693_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_07G213700 PE=4 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 3.9e-06 Identity = 25/28 (89.29%), Postives = 28/28 (100.00%), Query Frame = 3
BLAST of CU163435 vs. TrEMBL
Match: A0A0B2SFK3_GLYSO (Thioredoxin M3, chloroplastic OS=Glycine soja GN=glysoja_007594 PE=4 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 3.9e-06 Identity = 25/28 (89.29%), Postives = 28/28 (100.00%), Query Frame = 3
BLAST of CU163435 vs. TrEMBL
Match: I1KM08_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_07G213700 PE=4 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 3.9e-06 Identity = 25/28 (89.29%), Postives = 28/28 (100.00%), Query Frame = 3
BLAST of CU163435 vs. NCBI nr
Match: gi|659109928|ref|XP_008454954.1| (PREDICTED: thioredoxin M3, chloroplastic [Cucumis melo]) HSP 1 Score: 65.9 bits (159), Expect = 3.5e-08 Identity = 29/29 (100.00%), Postives = 29/29 (100.00%), Query Frame = 3
BLAST of CU163435 vs. NCBI nr
Match: gi|449438402|ref|XP_004136977.1| (PREDICTED: thioredoxin M3, chloroplastic [Cucumis sativus]) HSP 1 Score: 65.9 bits (159), Expect = 3.5e-08 Identity = 29/29 (100.00%), Postives = 29/29 (100.00%), Query Frame = 3
BLAST of CU163435 vs. NCBI nr
Match: gi|734425345|gb|KHN43064.1| (Thioredoxin M3, chloroplastic [Glycine soja]) HSP 1 Score: 61.2 bits (147), Expect = 8.7e-07 Identity = 25/28 (89.29%), Postives = 28/28 (100.00%), Query Frame = 3
BLAST of CU163435 vs. NCBI nr
Match: gi|351725753|ref|NP_001238639.1| (uncharacterized protein LOC100306680 [Glycine max]) HSP 1 Score: 61.2 bits (147), Expect = 8.7e-07 Identity = 25/28 (89.29%), Postives = 28/28 (100.00%), Query Frame = 3
BLAST of CU163435 vs. NCBI nr
Match: gi|1021585371|ref|XP_016182020.1| (PREDICTED: thioredoxin M3, chloroplastic-like isoform X1 [Arachis ipaensis]) HSP 1 Score: 61.2 bits (147), Expect = 8.7e-07 Identity = 25/28 (89.29%), Postives = 28/28 (100.00%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|