CU162313 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTTTCCTTCTTCGATAAGTTCCTGAAATGCCTTTCAGTTGCTCTATAAAAGGCACACTTGGCCTCCATTTCGAAGAATCATAAACAAAAGACCCAAATAGGGGAACATACCGGTCTGGCCAGTGTATTTGCAGTAAGTCAATGTAGTCAGTGTTCAGCCGCTTCAGACTTTTCTCTACACTTTCTCTGATATTGGCACGATCAAC
BLAST of CU162313 vs. Swiss-Prot
Match: TAS_SHIFL (Protein tas OS=Shigella flexneri GN=tas PE=3 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 4.9e-09 Identity = 29/68 (42.65%), Postives = 38/68 (55.88%), Query Frame = -1
BLAST of CU162313 vs. Swiss-Prot
Match: TAS_ECOLI (Protein tas OS=Escherichia coli (strain K12) GN=tas PE=1 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 4.9e-09 Identity = 29/68 (42.65%), Postives = 38/68 (55.88%), Query Frame = -1
BLAST of CU162313 vs. Swiss-Prot
Match: ALKE_BABBO (Aldo-keto reductase (Fragment) OS=Babesia bovis PE=2 SV=1) HSP 1 Score: 58.9 bits (141), Expect = 2.5e-08 Identity = 31/67 (46.27%), Postives = 40/67 (59.70%), Query Frame = -1
BLAST of CU162313 vs. Swiss-Prot
Match: GS69_BACSU (General stress protein 69 OS=Bacillus subtilis (strain 168) GN=yhdN PE=1 SV=2) HSP 1 Score: 53.9 bits (128), Expect = 7.9e-07 Identity = 24/35 (68.57%), Postives = 25/35 (71.43%), Query Frame = -1
BLAST of CU162313 vs. TrEMBL
Match: A0A0A0LPX0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G031740 PE=4 SV=1) HSP 1 Score: 123.2 bits (308), Expect = 1.2e-25 Identity = 58/58 (100.00%), Postives = 58/58 (100.00%), Query Frame = -1
BLAST of CU162313 vs. TrEMBL
Match: A0A0D2NHD1_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_002G025500 PE=4 SV=1) HSP 1 Score: 114.8 bits (286), Expect = 4.2e-23 Identity = 51/60 (85.00%), Postives = 55/60 (91.67%), Query Frame = -1
BLAST of CU162313 vs. TrEMBL
Match: A0A0B0PIP2_GOSAR (Protein tas OS=Gossypium arboreum GN=F383_09383 PE=4 SV=1) HSP 1 Score: 114.8 bits (286), Expect = 4.2e-23 Identity = 51/60 (85.00%), Postives = 55/60 (91.67%), Query Frame = -1
BLAST of CU162313 vs. TrEMBL
Match: A0A0D2Q702_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_002G025400 PE=4 SV=1) HSP 1 Score: 114.8 bits (286), Expect = 4.2e-23 Identity = 51/60 (85.00%), Postives = 55/60 (91.67%), Query Frame = -1
BLAST of CU162313 vs. TrEMBL
Match: A0A0D2M5Y7_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_002G025400 PE=4 SV=1) HSP 1 Score: 114.8 bits (286), Expect = 4.2e-23 Identity = 51/60 (85.00%), Postives = 55/60 (91.67%), Query Frame = -1
BLAST of CU162313 vs. NCBI nr
Match: gi|449439219|ref|XP_004137384.1| (PREDICTED: aldo-keto reductase [Cucumis sativus]) HSP 1 Score: 124.8 bits (312), Expect = 5.8e-26 Identity = 58/58 (100.00%), Postives = 58/58 (100.00%), Query Frame = -1
BLAST of CU162313 vs. NCBI nr
Match: gi|700208854|gb|KGN63950.1| (hypothetical protein Csa_1G031740 [Cucumis sativus]) HSP 1 Score: 124.8 bits (312), Expect = 5.8e-26 Identity = 58/58 (100.00%), Postives = 58/58 (100.00%), Query Frame = -1
BLAST of CU162313 vs. NCBI nr
Match: gi|659068729|ref|XP_008445879.1| (PREDICTED: homeobox-leucine zipper protein HDG11-like [Cucumis melo]) HSP 1 Score: 122.5 bits (306), Expect = 2.9e-25 Identity = 56/58 (96.55%), Postives = 58/58 (100.00%), Query Frame = -1
BLAST of CU162313 vs. NCBI nr
Match: gi|823130287|ref|XP_012452809.1| (PREDICTED: aldo-keto reductase-like [Gossypium raimondii]) HSP 1 Score: 116.7 bits (291), Expect = 1.6e-23 Identity = 51/60 (85.00%), Postives = 55/60 (91.67%), Query Frame = -1
BLAST of CU162313 vs. NCBI nr
Match: gi|728846875|gb|KHG26318.1| (Protein tas [Gossypium arboreum]) HSP 1 Score: 116.7 bits (291), Expect = 1.6e-23 Identity = 51/60 (85.00%), Postives = 55/60 (91.67%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|