CU161948 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CAAACGCTCCATAATTCATCACTGTCATCAGCATCAATCAAGTCAGAGTGTTCTTTTGCCTGCTGCCTCGTCTTTCTTGTCTCATCTTCGAGACGATTTTTTTTCTGCTCCTTATCGTCTGCCTCATCATCGCTTTCTGTCCATAAAGTAGATTCTTCTTCATTCATCTGCTTTTCCCAGGCTTTCCTAAATTCCTTATCACCAGGCCGTACAGTTCCAAAGAGGTCATAATGTTTGCA
BLAST of CU161948 vs. TrEMBL
Match: A0A0A0L8W2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G185140 PE=4 SV=1) HSP 1 Score: 167.2 bits (422), Expect = 8.3e-39 Identity = 78/79 (98.73%), Postives = 78/79 (98.73%), Query Frame = -1
BLAST of CU161948 vs. TrEMBL
Match: A0A067JFH7_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_02498 PE=4 SV=1) HSP 1 Score: 115.5 bits (288), Expect = 2.9e-23 Identity = 56/81 (69.14%), Postives = 67/81 (82.72%), Query Frame = -1
BLAST of CU161948 vs. TrEMBL
Match: W9RE63_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_004899 PE=4 SV=1) HSP 1 Score: 112.1 bits (279), Expect = 3.2e-22 Identity = 53/79 (67.09%), Postives = 68/79 (86.08%), Query Frame = -1
BLAST of CU161948 vs. TrEMBL
Match: A0A061E9Q1_THECC (Uncharacterized protein OS=Theobroma cacao GN=TCM_011054 PE=4 SV=1) HSP 1 Score: 109.0 bits (271), Expect = 2.7e-21 Identity = 57/84 (67.86%), Postives = 67/84 (79.76%), Query Frame = -1
BLAST of CU161948 vs. TrEMBL
Match: B9T7Q1_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_0140630 PE=4 SV=1) HSP 1 Score: 108.6 bits (270), Expect = 3.5e-21 Identity = 54/83 (65.06%), Postives = 67/83 (80.72%), Query Frame = -1
BLAST of CU161948 vs. NCBI nr
Match: gi|449445963|ref|XP_004140741.1| (PREDICTED: uncharacterized protein LOC101207731 [Cucumis sativus]) HSP 1 Score: 156.0 bits (393), Expect = 2.7e-35 Identity = 78/79 (98.73%), Postives = 78/79 (98.73%), Query Frame = -1
BLAST of CU161948 vs. NCBI nr
Match: gi|659114512|ref|XP_008457087.1| (PREDICTED: uncharacterized protein LOC103496851 isoform X2 [Cucumis melo]) HSP 1 Score: 145.2 bits (365), Expect = 4.8e-32 Identity = 73/78 (93.59%), Postives = 75/78 (96.15%), Query Frame = -1
BLAST of CU161948 vs. NCBI nr
Match: gi|659114506|ref|XP_008457085.1| (PREDICTED: uncharacterized protein LOC103496851 isoform X1 [Cucumis melo]) HSP 1 Score: 145.2 bits (365), Expect = 4.8e-32 Identity = 73/78 (93.59%), Postives = 75/78 (96.15%), Query Frame = -1
BLAST of CU161948 vs. NCBI nr
Match: gi|802761922|ref|XP_012089915.1| (PREDICTED: uncharacterized protein LOC105648208 [Jatropha curcas]) HSP 1 Score: 104.4 bits (259), Expect = 9.5e-20 Identity = 56/81 (69.14%), Postives = 67/81 (82.72%), Query Frame = -1
BLAST of CU161948 vs. NCBI nr
Match: gi|703101160|ref|XP_010097113.1| (hypothetical protein L484_004899 [Morus notabilis]) HSP 1 Score: 100.9 bits (250), Expect = 1.0e-18 Identity = 53/79 (67.09%), Postives = 68/79 (86.08%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|