CU161578 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GAGCTTCACGGGGTTTTTAGATCAATAGGAGATGAGCGGTGCACGTTAGAGGATTGCGGGCGTATGATAAGGGATGAGGAAGAGACACATGAAGAAAAGCTCGAGCGG
BLAST of CU161578 vs. TrEMBL
Match: A0A0A0L0H1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G355130 PE=4 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 1.1e-06 Identity = 26/28 (92.86%), Postives = 27/28 (96.43%), Query Frame = 1
BLAST of CU161578 vs. NCBI nr
Match: gi|449467126|ref|XP_004151276.1| (PREDICTED: probable calcium-binding protein CML36 [Cucumis sativus]) HSP 1 Score: 58.9 bits (141), Expect = 2.1e-06 Identity = 26/28 (92.86%), Postives = 27/28 (96.43%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|