CU161234 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AATTGTTGAGAGATCAGCATAGGTTGTGTAATCCACAATTTTTGCCCCAAATGACTTCATTACACGACCACCTTCTTCTACAGCCTTGTGAAGCCCTGCTTCATCTGTTTTTTCGTTACTAATGTTTAGAACCACATTTTTTCTGCGTACGAATCTAAAACTTGGGGCTTTATTTTAAATCCTGTCACCCGAACAATGTCGCCCATGCAATAACGGTACAGCCCAGCAATAATATAGTA
BLAST of CU161234 vs. Swiss-Prot
Match: GH34_ARATH (Indole-3-acetic acid-amido synthetase GH3.4 OS=Arabidopsis thaliana GN=GH3.4 PE=1 SV=1) HSP 1 Score: 70.9 bits (172), Expect = 7.3e-12 Identity = 30/58 (51.72%), Postives = 43/58 (74.14%), Query Frame = -3
HSP 2 Score: 33.1 bits (74), Expect = 1.7e+00 Identity = 14/17 (82.35%), Postives = 14/17 (82.35%), Query Frame = -1
BLAST of CU161234 vs. Swiss-Prot
Match: GH32_ORYSJ (Probable indole-3-acetic acid-amido synthetase GH3.2 OS=Oryza sativa subsp. japonica GN=GH3.2 PE=2 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 1.6e-11 Identity = 33/58 (56.90%), Postives = 41/58 (70.69%), Query Frame = -3
BLAST of CU161234 vs. Swiss-Prot
Match: GH32_ARATH (Indole-3-acetic acid-amido synthetase GH3.2 OS=Arabidopsis thaliana GN=GH3.2 PE=1 SV=3) HSP 1 Score: 69.3 bits (168), Expect = 2.1e-11 Identity = 29/58 (50.00%), Postives = 42/58 (72.41%), Query Frame = -3
HSP 2 Score: 33.1 bits (74), Expect = 1.7e+00 Identity = 14/17 (82.35%), Postives = 14/17 (82.35%), Query Frame = -1
BLAST of CU161234 vs. Swiss-Prot
Match: GH34_ORYSJ (Probable indole-3-acetic acid-amido synthetase GH3.4 OS=Oryza sativa subsp. japonica GN=GH3.4 PE=2 SV=1) HSP 1 Score: 68.9 bits (167), Expect = 2.8e-11 Identity = 33/57 (57.89%), Postives = 40/57 (70.18%), Query Frame = -3
HSP 2 Score: 31.6 bits (70), Expect = 4.9e+00 Identity = 12/18 (66.67%), Postives = 14/18 (77.78%), Query Frame = -1
BLAST of CU161234 vs. Swiss-Prot
Match: GH31_ORYSJ (Probable indole-3-acetic acid-amido synthetase GH3.1 OS=Oryza sativa subsp. japonica GN=GH3.1 PE=2 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 1.0e-10 Identity = 31/58 (53.45%), Postives = 40/58 (68.97%), Query Frame = -3
HSP 2 Score: 32.3 bits (72), Expect = 2.9e+00 Identity = 13/20 (65.00%), Postives = 15/20 (75.00%), Query Frame = -1
BLAST of CU161234 vs. TrEMBL
Match: A0A0A0KAF9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G125240 PE=4 SV=1) HSP 1 Score: 119.8 bits (299), Expect = 1.5e-24 Identity = 62/72 (86.11%), Postives = 64/72 (88.89%), Query Frame = -3
BLAST of CU161234 vs. TrEMBL
Match: A0A0A0KAF9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G125240 PE=4 SV=1) HSP 1 Score: 43.1 bits (100), Expect = 1.8e-01 Identity = 19/20 (95.00%), Postives = 19/20 (95.00%), Query Frame = -1
HSP 2 Score: 79.0 bits (193), Expect = 3.0e-12 Identity = 39/58 (67.24%), Postives = 43/58 (74.14%), Query Frame = -3
BLAST of CU161234 vs. TrEMBL
Match: A0A0A0LHA0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G081190 PE=4 SV=1) HSP 1 Score: 32.3 bits (72), Expect = 3.2e+02 Identity = 15/20 (75.00%), Postives = 16/20 (80.00%), Query Frame = -1
HSP 2 Score: 76.3 bits (186), Expect = 1.9e-11 Identity = 34/58 (58.62%), Postives = 45/58 (77.59%), Query Frame = -3
BLAST of CU161234 vs. TrEMBL
Match: A0A0D2SMB3_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_005G234200 PE=4 SV=1) HSP 1 Score: 73.6 bits (179), Expect = 1.2e-10 Identity = 33/58 (56.90%), Postives = 43/58 (74.14%), Query Frame = -3
BLAST of CU161234 vs. TrEMBL
Match: A0A0D2SMB3_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_005G234200 PE=4 SV=1) HSP 1 Score: 29.6 bits (65), Expect = 2.1e+03 Identity = 13/17 (76.47%), Postives = 15/17 (88.24%), Query Frame = -1
HSP 2 Score: 73.2 bits (178), Expect = 1.6e-10 Identity = 33/58 (56.90%), Postives = 45/58 (77.59%), Query Frame = -3
BLAST of CU161234 vs. NCBI nr
Match: gi|449444564|ref|XP_004140044.1| (PREDICTED: indole-3-acetic acid-amido synthetase GH3.6-like [Cucumis sativus]) HSP 1 Score: 121.3 bits (303), Expect = 7.5e-25 Identity = 62/72 (86.11%), Postives = 64/72 (88.89%), Query Frame = -3
BLAST of CU161234 vs. NCBI nr
Match: gi|659094768|ref|XP_008448232.1| (PREDICTED: indole-3-acetic acid-amido synthetase GH3.6-like [Cucumis melo]) HSP 1 Score: 113.2 bits (282), Expect = 2.0e-22 Identity = 57/72 (79.17%), Postives = 61/72 (84.72%), Query Frame = -3
BLAST of CU161234 vs. NCBI nr
Match: gi|659082377|ref|XP_008441807.1| (PREDICTED: indole-3-acetic acid-amido synthetase GH3.5-like [Cucumis melo]) HSP 1 Score: 81.6 bits (200), Expect = 6.6e-13 Identity = 42/72 (58.33%), Postives = 50/72 (69.44%), Query Frame = -3
BLAST of CU161234 vs. NCBI nr
Match: gi|778668015|ref|XP_011649024.1| (PREDICTED: indole-3-acetic acid-amido synthetase GH3.5-like isoform X2 [Cucumis sativus]) HSP 1 Score: 79.7 bits (195), Expect = 2.5e-12 Identity = 39/58 (67.24%), Postives = 43/58 (74.14%), Query Frame = -3
BLAST of CU161234 vs. NCBI nr
Match: gi|449442409|ref|XP_004138974.1| (PREDICTED: indole-3-acetic acid-amido synthetase GH3.5-like isoform X1 [Cucumis sativus]) HSP 1 Score: 79.7 bits (195), Expect = 2.5e-12 Identity = 39/58 (67.24%), Postives = 43/58 (74.14%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|