CU160975 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGAGTTGGGTTATTAAAGTTCAAGACCCCATTAAAGCCATGTTGTTTTGGGGTGAGCAGTGAGTTTGAATGTGGGAGTGTGGATGAACAAGGGAATAAAAAATTTAGTAGTTATGTAATGATCCCAAATCAGCTTTCTTTTGGGATTCTGTTCATCCCACTCAAACAGGATGGGCTCATGCATTTTCCTCTTTTACATCATTTCTCTAATCACTATTTTGATATACATAAAGTT
BLAST of CU160975 vs. Swiss-Prot
Match: GDL71_ARATH (GDSL esterase/lipase At5g03610 OS=Arabidopsis thaliana GN=At5g03610 PE=2 SV=1) HSP 1 Score: 52.8 bits (125), Expect = 2.0e-06 Identity = 21/33 (63.64%), Postives = 25/33 (75.76%), Query Frame = 1
HSP 2 Score: 42.0 bits (97), Expect = 3.5e-03 Identity = 13/21 (61.90%), Postives = 17/21 (80.95%), Query Frame = 3
BLAST of CU160975 vs. TrEMBL
Match: A0A0A0KEW4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G452020 PE=4 SV=1) HSP 1 Score: 78.6 bits (192), Expect = 3.8e-12 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = 1
BLAST of CU160975 vs. TrEMBL
Match: A0A0A0KEW4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G452020 PE=4 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 1.1e-06 Identity = 24/24 (100.00%), Postives = 24/24 (100.00%), Query Frame = 3
HSP 2 Score: 57.4 bits (137), Expect = 9.1e-06 Identity = 23/30 (76.67%), Postives = 26/30 (86.67%), Query Frame = 1
BLAST of CU160975 vs. TrEMBL
Match: A0A0A0KIM6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G452040 PE=4 SV=1) HSP 1 Score: 38.5 bits (88), Expect = 4.3e+00 Identity = 14/21 (66.67%), Postives = 15/21 (71.43%), Query Frame = 3
BLAST of CU160975 vs. NCBI nr
Match: gi|700193046|gb|KGN48250.1| (hypothetical protein Csa_6G452020 [Cucumis sativus]) HSP 1 Score: 80.9 bits (198), Expect = 1.1e-12 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = 1
BLAST of CU160975 vs. NCBI nr
Match: gi|449451259|ref|XP_004143379.1| (PREDICTED: GDSL esterase/lipase At5g03610-like [Cucumis sativus]) HSP 1 Score: 80.9 bits (198), Expect = 1.1e-12 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = 1
BLAST of CU160975 vs. NCBI nr
Match: gi|659125402|ref|XP_008462669.1| (PREDICTED: GDSL esterase/lipase At5g03610-like, partial [Cucumis melo]) HSP 1 Score: 74.7 bits (182), Expect = 7.9e-11 Identity = 32/35 (91.43%), Postives = 33/35 (94.29%), Query Frame = 1
BLAST of CU160975 vs. NCBI nr
Match: gi|659125187|ref|XP_008462555.1| (PREDICTED: GDSL esterase/lipase At5g03610-like [Cucumis melo]) HSP 1 Score: 61.6 bits (148), Expect = 6.9e-07 Identity = 25/36 (69.44%), Postives = 29/36 (80.56%), Query Frame = 1
BLAST of CU160975 vs. NCBI nr
Match: gi|694381095|ref|XP_009366645.1| (PREDICTED: GDSL esterase/lipase At5g03610-like [Pyrus x bretschneideri]) HSP 1 Score: 59.3 bits (142), Expect = 3.4e-06 Identity = 21/35 (60.00%), Postives = 30/35 (85.71%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|