CU160736 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTTCTTCTTTTCTTGGATTTTCTTCCCATATCTCTGCATTTTAGCTCCATCAACGGGAATGTCAGAGATTGCAATAGAGTCACTTGACATCAAAGCAGAGCCGGAGCATGAACTTGTACAAGGGAACTTGCCAGAGGATTGTTTTGGTGACTTAATTGCTTTACTATCCAGTTAACTTTTTATGGACTCCAGCAGGCTTCTACATCTGAGTGAAT
BLAST of CU160736 vs. TrEMBL
Match: A0A0A0LT77_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G043170 PE=4 SV=1) HSP 1 Score: 123.6 bits (309), Expect = 9.4e-26 Identity = 64/70 (91.43%), Postives = 64/70 (91.43%), Query Frame = -3
BLAST of CU160736 vs. NCBI nr
Match: gi|778657520|ref|XP_004137638.2| (PREDICTED: uncharacterized protein LOC101212209 [Cucumis sativus]) HSP 1 Score: 118.2 bits (295), Expect = 5.7e-24 Identity = 64/70 (91.43%), Postives = 64/70 (91.43%), Query Frame = -3
BLAST of CU160736 vs. NCBI nr
Match: gi|659066971|ref|XP_008436999.1| (PREDICTED: uncharacterized protein LOC103482558 [Cucumis melo]) HSP 1 Score: 104.0 bits (258), Expect = 1.1e-19 Identity = 57/70 (81.43%), Postives = 59/70 (84.29%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|