CU160114 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGGCGGTAACCGTGATCGTCACTCCAGGAGGAGCATTGATGGTCGCATTGTAGACAGAGATAGGATGGCCGACGTTTGTGACTCGTCGTCGGAACGTTGTTGTCATCGGTTGGTTGGTGCTTTTGAGACTGAGCTGAAAAGTTGGATAATTGAGTGAGTCGTGTCCTTGGCCGGGGATTAGATTGGAACAGTTTTATGGATTTGGTT
BLAST of CU160114 vs. Swiss-Prot
Match: SBT4E_ARATH (Subtilisin-like protease SBT4.14 OS=Arabidopsis thaliana GN=SBT4.14 PE=2 SV=1) HSP 1 Score: 84.7 bits (208), Expect = 4.2e-16 Identity = 39/62 (62.90%), Postives = 44/62 (70.97%), Query Frame = -3
BLAST of CU160114 vs. TrEMBL
Match: A0A0A0KME6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G000010 PE=4 SV=1) HSP 1 Score: 133.7 bits (335), Expect = 8.7e-29 Identity = 63/63 (100.00%), Postives = 63/63 (100.00%), Query Frame = -3
BLAST of CU160114 vs. TrEMBL
Match: D7U7Q0_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_15s0048g01210 PE=4 SV=1) HSP 1 Score: 95.1 bits (235), Expect = 3.4e-17 Identity = 46/63 (73.02%), Postives = 50/63 (79.37%), Query Frame = -3
BLAST of CU160114 vs. TrEMBL
Match: V4MYM6_EUTSA (Uncharacterized protein OS=Eutrema salsugineum GN=EUTSA_v10028458mg PE=3 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 2.5e-15 Identity = 41/62 (66.13%), Postives = 47/62 (75.81%), Query Frame = -3
BLAST of CU160114 vs. TrEMBL
Match: M4F8B4_BRARP (Uncharacterized protein OS=Brassica rapa subsp. pekinensis PE=3 SV=1) HSP 1 Score: 88.6 bits (218), Expect = 3.2e-15 Identity = 41/62 (66.13%), Postives = 47/62 (75.81%), Query Frame = -3
BLAST of CU160114 vs. TrEMBL
Match: A0A067HDF0_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g004503mg PE=4 SV=1) HSP 1 Score: 87.4 bits (215), Expect = 7.2e-15 Identity = 41/62 (66.13%), Postives = 49/62 (79.03%), Query Frame = -3
BLAST of CU160114 vs. NCBI nr
Match: gi|778697899|ref|XP_011654432.1| (PREDICTED: subtilisin-like protease SBT4.14 [Cucumis sativus]) HSP 1 Score: 131.3 bits (329), Expect = 6.2e-28 Identity = 63/63 (100.00%), Postives = 63/63 (100.00%), Query Frame = -3
BLAST of CU160114 vs. NCBI nr
Match: gi|659109517|ref|XP_008454753.1| (PREDICTED: xylem serine proteinase 1-like [Cucumis melo]) HSP 1 Score: 114.0 bits (284), Expect = 1.0e-22 Identity = 54/63 (85.71%), Postives = 57/63 (90.48%), Query Frame = -3
BLAST of CU160114 vs. NCBI nr
Match: gi|778730647|ref|XP_004140478.2| (PREDICTED: subtilisin-like protease SBT4.14 [Cucumis sativus]) HSP 1 Score: 95.5 bits (236), Expect = 3.8e-17 Identity = 43/62 (69.35%), Postives = 52/62 (83.87%), Query Frame = -3
BLAST of CU160114 vs. NCBI nr
Match: gi|225453849|ref|XP_002272598.1| (PREDICTED: xylem serine proteinase 1 [Vitis vinifera]) HSP 1 Score: 92.8 bits (229), Expect = 2.5e-16 Identity = 46/63 (73.02%), Postives = 50/63 (79.37%), Query Frame = -3
BLAST of CU160114 vs. NCBI nr
Match: gi|659109757|ref|XP_008454861.1| (PREDICTED: xylem serine proteinase 1-like [Cucumis melo]) HSP 1 Score: 90.5 bits (223), Expect = 1.2e-15 Identity = 43/62 (69.35%), Postives = 49/62 (79.03%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|