CU159949 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTCGTCTACACCATTTCCAAACTTTGAGCGTTCACCACTATGTAATTCCAGCTGAACTCTAGGAACTGACGACGATCTCTGACTCTTCACTGGACTACGGGGGACCGCTCCATTGCTTAACCGATTGAACCTGGAAACCCTGGGAGCAATAGGATAAACAATCGGAATAGAAGAGACGTCGGAGATCGGAACAACGGAAGGAGAGAGAATAGAAAGTG
BLAST of CU159949 vs. TrEMBL
Match: A0A0A0LT43_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G030680 PE=4 SV=1) HSP 1 Score: 99.4 bits (246), Expect = 1.9e-18 Identity = 49/49 (100.00%), Postives = 49/49 (100.00%), Query Frame = -3
BLAST of CU159949 vs. NCBI nr
Match: gi|778656685|ref|XP_011649510.1| (PREDICTED: extra-large guanine nucleotide-binding protein 3-like isoform X1 [Cucumis sativus]) HSP 1 Score: 97.8 bits (242), Expect = 8.1e-18 Identity = 49/49 (100.00%), Postives = 49/49 (100.00%), Query Frame = -3
BLAST of CU159949 vs. NCBI nr
Match: gi|700208846|gb|KGN63942.1| (hypothetical protein Csa_1G030680 [Cucumis sativus]) HSP 1 Score: 97.8 bits (242), Expect = 8.1e-18 Identity = 49/49 (100.00%), Postives = 49/49 (100.00%), Query Frame = -3
BLAST of CU159949 vs. NCBI nr
Match: gi|778656688|ref|XP_011649515.1| (PREDICTED: extra-large guanine nucleotide-binding protein 3-like isoform X2 [Cucumis sativus]) HSP 1 Score: 97.8 bits (242), Expect = 8.1e-18 Identity = 49/49 (100.00%), Postives = 49/49 (100.00%), Query Frame = -3
BLAST of CU159949 vs. NCBI nr
Match: gi|659066231|ref|XP_008444133.1| (PREDICTED: extra-large guanine nucleotide-binding protein 3-like isoform X1 [Cucumis melo]) HSP 1 Score: 94.4 bits (233), Expect = 8.9e-17 Identity = 47/49 (95.92%), Postives = 48/49 (97.96%), Query Frame = -3
BLAST of CU159949 vs. NCBI nr
Match: gi|659066233|ref|XP_008444885.1| (PREDICTED: extra-large guanine nucleotide-binding protein 3-like isoform X2 [Cucumis melo]) HSP 1 Score: 94.4 bits (233), Expect = 8.9e-17 Identity = 47/49 (95.92%), Postives = 48/49 (97.96%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|