CU158362 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGTCTTTGGCTATCACGACTTCAATGAAACGATTAAGAGCAGTAAAGGAAGAGCCATTCTCCATTACACTTTTCTACTCTCTTCGCTCTTCATCTTCACCTTTTTCCTAATCTCCCCATCCCCCTTCATCACTTCCTTAATCCCACTCTCTATCTTCTCCGCCCTCACTATG
BLAST of CU158362 vs. TrEMBL
Match: A0A0A0L4D9_CUCSA (Glycosyltransferase OS=Cucumis sativus GN=Csa_4G618510 PE=3 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 3.2e-08 Identity = 33/34 (97.06%), Postives = 33/34 (97.06%), Query Frame = -2
BLAST of CU158362 vs. TrEMBL
Match: A0A0A0L4D9_CUCSA (Glycosyltransferase OS=Cucumis sativus GN=Csa_4G618510 PE=3 SV=1) HSP 1 Score: 43.1 bits (100), Expect = 1.3e-01 Identity = 21/21 (100.00%), Postives = 21/21 (100.00%), Query Frame = -1
BLAST of CU158362 vs. NCBI nr
Match: gi|778695494|ref|XP_004146062.2| (PREDICTED: anthocyanidin 3-O-glucosyltransferase 2-like [Cucumis sativus]) HSP 1 Score: 62.4 bits (150), Expect = 3.0e-07 Identity = 33/34 (97.06%), Postives = 33/34 (97.06%), Query Frame = -2
BLAST of CU158362 vs. NCBI nr
Match: gi|659129442|ref|XP_008464688.1| (PREDICTED: anthocyanidin 3-O-glucosyltransferase 2-like [Cucumis melo]) HSP 1 Score: 60.1 bits (144), Expect = 1.5e-06 Identity = 31/34 (91.18%), Postives = 32/34 (94.12%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|