CU157875 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GAGAGCAGAGTTTGAAGCTCCAACAACTTCAAGTTGAAACTGAAACTTCAAGGCAAGAAGCTAAACAGATGAAGCAAGAAACAGCCGAGCTTAAGCGAGATGCTGAAGCTAGTAGATGTTTCACAGAGGAATTGGTGATCAAACTGCAGATTCTACAGAAAGAGGCAGAAGAAGACAAAAGAAAGACAGAGAAGAAAG
BLAST of CU157875 vs. TrEMBL
Match: A0A0A0LVM1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G172600 PE=4 SV=1) HSP 1 Score: 109.8 bits (273), Expect = 1.3e-21 Identity = 58/64 (90.62%), Postives = 59/64 (92.19%), Query Frame = 3
BLAST of CU157875 vs. TrEMBL
Match: Q2HV31_MEDTR (Prefoldin OS=Medicago truncatula GN=MTR_2g027130 PE=4 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 5.8e-06 Identity = 26/59 (44.07%), Postives = 44/59 (74.58%), Query Frame = 3
BLAST of CU157875 vs. TrEMBL
Match: V7BRD3_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_006G136800g PE=4 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 5.8e-06 Identity = 28/61 (45.90%), Postives = 42/61 (68.85%), Query Frame = 3
BLAST of CU157875 vs. TrEMBL
Match: G7ZZU0_MEDTR (Putative uncharacterized protein OS=Medicago truncatula GN=MTR_091s0006 PE=4 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 7.6e-06 Identity = 29/63 (46.03%), Postives = 45/63 (71.43%), Query Frame = 3
BLAST of CU157875 vs. TrEMBL
Match: G7ZZU0_MEDTR (Putative uncharacterized protein OS=Medicago truncatula GN=MTR_091s0006 PE=4 SV=1) HSP 1 Score: 29.3 bits (64), Expect = 2.2e+03 Identity = 13/51 (25.49%), Postives = 32/51 (62.75%), Query Frame = 3
HSP 2 Score: 57.4 bits (137), Expect = 7.6e-06 Identity = 28/64 (43.75%), Postives = 44/64 (68.75%), Query Frame = 3
BLAST of CU157875 vs. NCBI nr
Match: gi|449443668|ref|XP_004139599.1| (PREDICTED: WEB family protein At1g12150 [Cucumis sativus]) HSP 1 Score: 96.3 bits (238), Expect = 2.1e-17 Identity = 58/64 (90.62%), Postives = 59/64 (92.19%), Query Frame = 3
BLAST of CU157875 vs. NCBI nr
Match: gi|659128639|ref|XP_008464300.1| (PREDICTED: WEB family protein At1g12150 [Cucumis melo]) HSP 1 Score: 89.4 bits (220), Expect = 2.6e-15 Identity = 54/64 (84.38%), Postives = 57/64 (89.06%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|