CU157567 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTATTTGATCAGCTGTGGGGGTTTATTTTGTCCAGCGAGACCGGAGAATGACGACCCATGGGTGAATCCAGTGGCAGAAGGAGCAGGGAGGCTGGCGGGGCTGGGGAGTGGGAGGGTGCTAGTTTGTGTGGCGGAGAAAGATGTGCTGAGGGACAGAGGAAGGCTTTACTTTGAGGCGTTGGGGGCAGTGGGTGGTTCGGGGTGGCGGAGATTGG
BLAST of CU157567 vs. TrEMBL
Match: A0A0A0LLA8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G360060 PE=4 SV=1) HSP 1 Score: 79.7 bits (195), Expect = 1.6e-12 Identity = 39/62 (62.90%), Postives = 39/62 (62.90%), Query Frame = 2
BLAST of CU157567 vs. TrEMBL
Match: A0A059BK51_EUCGR (Uncharacterized protein (Fragment) OS=Eucalyptus grandis GN=EUGRSUZ_F00245 PE=4 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 2.3e-08 Identity = 29/58 (50.00%), Postives = 35/58 (60.34%), Query Frame = 2
BLAST of CU157567 vs. TrEMBL
Match: A0A059BJS7_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_F00244 PE=4 SV=1) HSP 1 Score: 62.8 bits (151), Expect = 2.0e-07 Identity = 29/59 (49.15%), Postives = 35/59 (59.32%), Query Frame = 2
BLAST of CU157567 vs. TrEMBL
Match: M1B8Z9_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG400015446 PE=4 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 1.7e-06 Identity = 29/59 (49.15%), Postives = 33/59 (55.93%), Query Frame = 2
BLAST of CU157567 vs. TrEMBL
Match: A0A0D2SE85_GOSRA (Uncharacterized protein (Fragment) OS=Gossypium raimondii GN=B456_005G103600 PE=4 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 6.4e-06 Identity = 30/59 (50.85%), Postives = 33/59 (55.93%), Query Frame = 2
BLAST of CU157567 vs. NCBI nr
Match: gi|778671161|ref|XP_011649590.1| (PREDICTED: probable carboxylesterase 2 [Cucumis sativus]) HSP 1 Score: 80.9 bits (198), Expect = 1.0e-12 Identity = 39/62 (62.90%), Postives = 39/62 (62.90%), Query Frame = 2
BLAST of CU157567 vs. NCBI nr
Match: gi|659087794|ref|XP_008444640.1| (PREDICTED: probable carboxylesterase 2 [Cucumis melo]) HSP 1 Score: 80.9 bits (198), Expect = 1.0e-12 Identity = 39/62 (62.90%), Postives = 39/62 (62.90%), Query Frame = 2
BLAST of CU157567 vs. NCBI nr
Match: gi|629100979|gb|KCW66448.1| (hypothetical protein EUGRSUZ_F00245, partial [Eucalyptus grandis]) HSP 1 Score: 66.6 bits (161), Expect = 2.0e-08 Identity = 29/58 (50.00%), Postives = 35/58 (60.34%), Query Frame = 2
BLAST of CU157567 vs. NCBI nr
Match: gi|702383971|ref|XP_010064185.1| (PREDICTED: probable carboxylesterase 2 [Eucalyptus grandis]) HSP 1 Score: 66.6 bits (161), Expect = 2.0e-08 Identity = 29/58 (50.00%), Postives = 35/58 (60.34%), Query Frame = 2
BLAST of CU157567 vs. NCBI nr
Match: gi|702361483|ref|XP_010059959.1| (PREDICTED: probable carboxylesterase 2 [Eucalyptus grandis]) HSP 1 Score: 63.5 bits (153), Expect = 1.7e-07 Identity = 29/59 (49.15%), Postives = 35/59 (59.32%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|