CU157296 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTGGGTCGACAATAAACGGAAAATTCTTACCTGAAACCATTGACGGTGGAATTGCTTGTGAAGATTTGGATTGCAGAGAGATAAGGAACATAATATTGAACAAGGGTCTCGCCGTTGTTGACGGCGATTGGAACACCGGCACCGTAAGCGCTCCATTCGTCGTAACAATTCCAGAGATCGCCGAGGGTGAAATATTCAACCTTCTCTCTCTCCCATGGATGC
BLAST of CU157296 vs. TrEMBL
Match: A0A0A0KG73_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G128660 PE=4 SV=1) HSP 1 Score: 142.5 bits (358), Expect = 2.0e-31 Identity = 65/66 (98.48%), Postives = 65/66 (98.48%), Query Frame = -2
BLAST of CU157296 vs. TrEMBL
Match: A0A067JJL9_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_25823 PE=4 SV=1) HSP 1 Score: 134.8 bits (338), Expect = 4.2e-29 Identity = 60/66 (90.91%), Postives = 63/66 (95.45%), Query Frame = -2
BLAST of CU157296 vs. TrEMBL
Match: B9RW40_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_1175860 PE=4 SV=1) HSP 1 Score: 133.7 bits (335), Expect = 9.4e-29 Identity = 59/66 (89.39%), Postives = 64/66 (96.97%), Query Frame = -2
BLAST of CU157296 vs. TrEMBL
Match: A0A0D2NG02_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_005G204000 PE=4 SV=1) HSP 1 Score: 132.9 bits (333), Expect = 1.6e-28 Identity = 60/66 (90.91%), Postives = 62/66 (93.94%), Query Frame = -2
BLAST of CU157296 vs. TrEMBL
Match: M5XGX1_PRUPE (Uncharacterized protein (Fragment) OS=Prunus persica GN=PRUPE_ppa008669m2g PE=4 SV=1) HSP 1 Score: 131.3 bits (329), Expect = 4.7e-28 Identity = 59/66 (89.39%), Postives = 63/66 (95.45%), Query Frame = -2
BLAST of CU157296 vs. NCBI nr
Match: gi|449444342|ref|XP_004139934.1| (PREDICTED: uncharacterized protein LOC101222318 [Cucumis sativus]) HSP 1 Score: 145.2 bits (365), Expect = 4.5e-32 Identity = 65/66 (98.48%), Postives = 65/66 (98.48%), Query Frame = -2
BLAST of CU157296 vs. NCBI nr
Match: gi|659094859|ref|XP_008448279.1| (PREDICTED: uncharacterized protein LOC103490514 [Cucumis melo]) HSP 1 Score: 143.3 bits (360), Expect = 1.7e-31 Identity = 64/66 (96.97%), Postives = 65/66 (98.48%), Query Frame = -2
BLAST of CU157296 vs. NCBI nr
Match: gi|802752733|ref|XP_012088328.1| (PREDICTED: uncharacterized protein LOC105646971 [Jatropha curcas]) HSP 1 Score: 137.5 bits (345), Expect = 9.3e-30 Identity = 60/66 (90.91%), Postives = 63/66 (95.45%), Query Frame = -2
BLAST of CU157296 vs. NCBI nr
Match: gi|223542941|gb|EEF44477.1| (conserved hypothetical protein [Ricinus communis]) HSP 1 Score: 136.3 bits (342), Expect = 2.1e-29 Identity = 59/66 (89.39%), Postives = 64/66 (96.97%), Query Frame = -2
BLAST of CU157296 vs. NCBI nr
Match: gi|1000968399|ref|XP_002517959.2| (PREDICTED: uncharacterized protein LOC8262107 [Ricinus communis]) HSP 1 Score: 136.3 bits (342), Expect = 2.1e-29 Identity = 59/66 (89.39%), Postives = 64/66 (96.97%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|