CU157212 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GAGTTTATGCATTTGGAGAAGAATGGTGTAATTCCCCCTTCATCTGCTTGGCGTAGGGCTAAGTCTGGAAAAGACGTCATTATCGCCAATCTTGACACTGGTACACTTCTTTTTTTCTATTTTAATTAATATAGCAAAGATTTTATTCTTAGTATTTTACAAATTTAATTAATATAGCATAAATGATTGGAACAAATATGAAAACATAGGATAAAGACTTTGATG
BLAST of CU157212 vs. TrEMBL
Match: A0A0A0LVY8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G171040 PE=4 SV=1) HSP 1 Score: 73.2 bits (178), Expect = 1.5e-10 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = 1
BLAST of CU157212 vs. TrEMBL
Match: A0A0A0LYF1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G171030 PE=4 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 2.5e-08 Identity = 31/34 (91.18%), Postives = 31/34 (91.18%), Query Frame = 1
BLAST of CU157212 vs. NCBI nr
Match: gi|700209886|gb|KGN64982.1| (hypothetical protein Csa_1G171040 [Cucumis sativus]) HSP 1 Score: 76.3 bits (186), Expect = 2.6e-11 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = 1
BLAST of CU157212 vs. NCBI nr
Match: gi|449443664|ref|XP_004139597.1| (PREDICTED: subtilisin-like protease SBT5.4 [Cucumis sativus]) HSP 1 Score: 76.3 bits (186), Expect = 2.6e-11 Identity = 34/34 (100.00%), Postives = 34/34 (100.00%), Query Frame = 1
BLAST of CU157212 vs. NCBI nr
Match: gi|659128687|ref|XP_008464322.1| (PREDICTED: subtilisin-like protease [Cucumis melo]) HSP 1 Score: 74.7 bits (182), Expect = 7.6e-11 Identity = 33/34 (97.06%), Postives = 33/34 (97.06%), Query Frame = 1
BLAST of CU157212 vs. NCBI nr
Match: gi|659128619|ref|XP_008464289.1| (PREDICTED: LOW QUALITY PROTEIN: subtilisin-like protease [Cucumis melo]) HSP 1 Score: 69.3 bits (168), Expect = 3.2e-09 Identity = 30/34 (88.24%), Postives = 31/34 (91.18%), Query Frame = 1
BLAST of CU157212 vs. NCBI nr
Match: gi|778665004|ref|XP_011648463.1| (PREDICTED: subtilisin-like protease SBT5.4 [Cucumis sativus]) HSP 1 Score: 68.9 bits (167), Expect = 4.2e-09 Identity = 31/34 (91.18%), Postives = 31/34 (91.18%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|