CU157166 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GCTTGTTTGCGGTAAAGAAAAGCAGCCATATAACCAAATATAAATGATCCAAAAGGTATATTGGCTACAACAATGTTGTGGTTTATTGAGAAATTAGTTGCTCCAAATAAGTCAGTGGTTGTGGACACAGAAATTGAAGTAATTGCACCTGTGCATATTGCAATTATGGCAGTGCTCATACAAAGGCTCGTATCACTTGGACT
BLAST of CU157166 vs. Swiss-Prot
Match: NFD4_ARATH (Protein NUCLEAR FUSION DEFECTIVE 4 OS=Arabidopsis thaliana GN=NFD4 PE=3 SV=1) HSP 1 Score: 53.1 bits (126), Expect = 1.3e-06 Identity = 21/39 (53.85%), Postives = 28/39 (71.79%), Query Frame = -1
BLAST of CU157166 vs. TrEMBL
Match: A0A0A0LYD4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G533690 PE=4 SV=1) HSP 1 Score: 100.5 bits (249), Expect = 8.1e-19 Identity = 51/67 (76.12%), Postives = 51/67 (76.12%), Query Frame = -1
BLAST of CU157166 vs. TrEMBL
Match: G8GJ73_LINUS (Putative nodulin protein OS=Linum usitatissimum PE=4 SV=1) HSP 1 Score: 72.4 bits (176), Expect = 2.4e-10 Identity = 31/41 (75.61%), Postives = 37/41 (90.24%), Query Frame = -1
BLAST of CU157166 vs. TrEMBL
Match: I1JHJ4_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_02G233200 PE=4 SV=2) HSP 1 Score: 72.4 bits (176), Expect = 2.4e-10 Identity = 31/41 (75.61%), Postives = 37/41 (90.24%), Query Frame = -1
BLAST of CU157166 vs. TrEMBL
Match: A0A0B2SM98_GLYSO (Uncharacterized protein OS=Glycine soja GN=glysoja_022747 PE=4 SV=1) HSP 1 Score: 72.4 bits (176), Expect = 2.4e-10 Identity = 31/41 (75.61%), Postives = 37/41 (90.24%), Query Frame = -1
BLAST of CU157166 vs. TrEMBL
Match: A0A067LBI9_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_17339 PE=4 SV=1) HSP 1 Score: 72.0 bits (175), Expect = 3.1e-10 Identity = 31/42 (73.81%), Postives = 37/42 (88.10%), Query Frame = -1
BLAST of CU157166 vs. NCBI nr
Match: gi|778661856|ref|XP_011658866.1| (PREDICTED: protein NUCLEAR FUSION DEFECTIVE 4 [Cucumis sativus]) HSP 1 Score: 99.4 bits (246), Expect = 2.6e-18 Identity = 51/67 (76.12%), Postives = 51/67 (76.12%), Query Frame = -1
BLAST of CU157166 vs. NCBI nr
Match: gi|659114947|ref|XP_008457307.1| (PREDICTED: uncharacterized protein LOC103497028 [Cucumis melo]) HSP 1 Score: 97.1 bits (240), Expect = 1.3e-17 Identity = 49/67 (73.13%), Postives = 50/67 (74.63%), Query Frame = -1
BLAST of CU157166 vs. NCBI nr
Match: gi|1011994127|ref|XP_015950246.1| (PREDICTED: protein NUCLEAR FUSION DEFECTIVE 4-like [Arachis duranensis]) HSP 1 Score: 72.8 bits (177), Expect = 2.6e-10 Identity = 33/42 (78.57%), Postives = 37/42 (88.10%), Query Frame = -1
BLAST of CU157166 vs. NCBI nr
Match: gi|802540820|ref|XP_012078420.1| (PREDICTED: protein NUCLEAR FUSION DEFECTIVE 4 [Jatropha curcas]) HSP 1 Score: 70.9 bits (172), Expect = 9.8e-10 Identity = 31/42 (73.81%), Postives = 37/42 (88.10%), Query Frame = -1
BLAST of CU157166 vs. NCBI nr
Match: gi|355430069|gb|AER92595.1| (putative nodulin protein [Linum usitatissimum]) HSP 1 Score: 70.9 bits (172), Expect = 9.8e-10 Identity = 31/41 (75.61%), Postives = 37/41 (90.24%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|