CU157034 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGACTGAAGTCACTTCATGCACTTGCCGCTATTTTGTTGTCTAAGATGGGCAATAAGGGTGCCAGGGATTTGTTATCTTTACTGGGTATTGTGGTAAGTGCAAGCTATATATATCAAGTGATGTGATGAGTCTGATTGATATATTGTCAATCTGTTTTTTCTTATTCTTCCTTTTCTTTCTCATTGGTAAATTGTCGTAG
BLAST of CU157034 vs. TrEMBL
Match: A0A0A0KXT1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G097120 PE=4 SV=1) HSP 1 Score: 62.0 bits (149), Expect = 3.1e-07 Identity = 32/32 (100.00%), Postives = 32/32 (100.00%), Query Frame = 2
BLAST of CU157034 vs. NCBI nr
Match: gi|778691817|ref|XP_011653356.1| (PREDICTED: ABC transporter D family member 1 [Cucumis sativus]) HSP 1 Score: 60.1 bits (144), Expect = 1.7e-06 Identity = 32/32 (100.00%), Postives = 32/32 (100.00%), Query Frame = 2
BLAST of CU157034 vs. NCBI nr
Match: gi|700198496|gb|KGN53654.1| (hypothetical protein Csa_4G097120 [Cucumis sativus]) HSP 1 Score: 60.1 bits (144), Expect = 1.7e-06 Identity = 32/32 (100.00%), Postives = 32/32 (100.00%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|