CU156650 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TGGGTGCTATGGTGGATGAAGGCTGAAAAGACGTCGGCGGGAGCTTTGAGGATTGAGTTTGAAATGAGAAATTAGACGAATATTTGTTTTCTTCCTTAATGTTCTGCTGATTATATCCAAAATTGCTCTTCCAATTCAACGAGTGAGACGGGAAAGT
BLAST of CU156650 vs. TrEMBL
Match: G0Z734_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=WRKY2 PE=2 SV=1) HSP 1 Score: 112.1 bits (279), Expect = 2.1e-22 Identity = 52/52 (100.00%), Postives = 52/52 (100.00%), Query Frame = -1
BLAST of CU156650 vs. NCBI nr
Match: gi|525507238|ref|NP_001267657.1| (uncharacterized protein LOC101207158 [Cucumis sativus]) HSP 1 Score: 104.8 bits (260), Expect = 4.8e-20 Identity = 52/52 (100.00%), Postives = 52/52 (100.00%), Query Frame = -1
BLAST of CU156650 vs. NCBI nr
Match: gi|659114935|ref|XP_008457300.1| (PREDICTED: probable WRKY transcription factor 33 [Cucumis melo]) HSP 1 Score: 102.8 bits (255), Expect = 1.8e-19 Identity = 51/52 (98.08%), Postives = 51/52 (98.08%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|