CU156347 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGGAGAAAGTTTCGGAGTGCTCGACTCTAATTGGACTCAAATTAAGAACCCTAACTTTGTACAAAAGTTTCAACTATTGCAGACCATGTTGCACGGTAACTATATAAATGATTATTACAAGTACATGCAATGATCTATAGTTATATAGTATCAAAGTAACACTTTGTATAACATCTTTTTATGATATATATGCAGATCCAAATTCTAATGCATC
BLAST of CU156347 vs. TrEMBL
Match: A0A0A0K853_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G028440 PE=3 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 6.1e-09 Identity = 31/41 (75.61%), Postives = 34/41 (82.93%), Query Frame = 3
BLAST of CU156347 vs. TrEMBL
Match: A0A0A0L644_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G186670 PE=4 SV=1) HSP 1 Score: 66.2 bits (160), Expect = 1.8e-08 Identity = 31/42 (73.81%), Postives = 34/42 (80.95%), Query Frame = 3
BLAST of CU156347 vs. NCBI nr
Match: gi|778721997|ref|XP_011658389.1| (PREDICTED: uncharacterized protein LOC101207450 [Cucumis sativus]) HSP 1 Score: 67.8 bits (164), Expect = 8.8e-09 Identity = 31/41 (75.61%), Postives = 34/41 (82.93%), Query Frame = 3
BLAST of CU156347 vs. NCBI nr
Match: gi|700202307|gb|KGN57440.1| (hypothetical protein Csa_3G186670 [Cucumis sativus]) HSP 1 Score: 66.2 bits (160), Expect = 2.6e-08 Identity = 31/42 (73.81%), Postives = 34/42 (80.95%), Query Frame = 3
BLAST of CU156347 vs. NCBI nr
Match: gi|659090006|ref|XP_008445780.1| (PREDICTED: uncharacterized protein LOC103488703 [Cucumis melo]) HSP 1 Score: 62.8 bits (151), Expect = 2.8e-07 Identity = 29/41 (70.73%), Postives = 33/41 (80.49%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|