CU156305 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGAAAATTCCGGTGCCGGCTGGACTCTGGAGTTGAGGATCGAAAATCCGGTGGCCTCTGCCGGATCGTCGCGGCCTTGGGCAGTGATCATGTTGGCTTGGTGAAGAATCGGCTGTCGGACGAAGATTTCGCAGTTCTGGAGGACGGCGGCCGAGTTGCCAAAGATGAAGTCGATGGTGCCATAGATTTTGCAGTCGCGGTAGAATTGG
BLAST of CU156305 vs. Swiss-Prot
Match: PME36_ARATH (Probable pectinesterase/pectinesterase inhibitor 36 OS=Arabidopsis thaliana GN=PME36 PE=2 SV=2) HSP 1 Score: 107.1 bits (266), Expect = 8.0e-23 Identity = 49/68 (72.06%), Postives = 56/68 (82.35%), Query Frame = -2
BLAST of CU156305 vs. Swiss-Prot
Match: PME59_ARATH (Probable pectinesterase/pectinesterase inhibitor 59 OS=Arabidopsis thaliana GN=PME59 PE=2 SV=1) HSP 1 Score: 97.1 bits (240), Expect = 8.3e-20 Identity = 45/67 (67.16%), Postives = 52/67 (77.61%), Query Frame = -2
BLAST of CU156305 vs. Swiss-Prot
Match: PME47_ARATH (Probable pectinesterase/pectinesterase inhibitor 47 OS=Arabidopsis thaliana GN=PME47 PE=2 SV=1) HSP 1 Score: 92.4 bits (228), Expect = 2.0e-18 Identity = 39/69 (56.52%), Postives = 50/69 (72.46%), Query Frame = -2
BLAST of CU156305 vs. Swiss-Prot
Match: PME25_ARATH (Probable pectinesterase/pectinesterase inhibitor 25 OS=Arabidopsis thaliana GN=PME25 PE=2 SV=1) HSP 1 Score: 91.3 bits (225), Expect = 4.5e-18 Identity = 39/69 (56.52%), Postives = 50/69 (72.46%), Query Frame = -2
BLAST of CU156305 vs. Swiss-Prot
Match: PME_ACTDE (Pectinesterase OS=Actinidia deliciosa PE=1 SV=1) HSP 1 Score: 89.4 bits (220), Expect = 1.7e-17 Identity = 40/67 (59.70%), Postives = 49/67 (73.13%), Query Frame = -2
BLAST of CU156305 vs. TrEMBL
Match: A0A0A0L3U7_CUCSA (Pectinesterase OS=Cucumis sativus GN=Csa_3G126790 PE=4 SV=1) HSP 1 Score: 144.1 bits (362), Expect = 6.6e-32 Identity = 69/69 (100.00%), Postives = 69/69 (100.00%), Query Frame = -2
BLAST of CU156305 vs. TrEMBL
Match: A0A0J8BJ43_BETVU (Pectinesterase OS=Beta vulgaris subsp. vulgaris GN=BVRB_1g018820 PE=4 SV=1) HSP 1 Score: 114.4 bits (285), Expect = 5.6e-23 Identity = 52/68 (76.47%), Postives = 59/68 (86.76%), Query Frame = -2
BLAST of CU156305 vs. TrEMBL
Match: A0A0K9QXE3_SPIOL (Pectinesterase OS=Spinacia oleracea GN=SOVF_130330 PE=4 SV=1) HSP 1 Score: 113.6 bits (283), Expect = 9.5e-23 Identity = 51/68 (75.00%), Postives = 59/68 (86.76%), Query Frame = -2
BLAST of CU156305 vs. TrEMBL
Match: A0A0D2PSW3_GOSRA (Pectinesterase OS=Gossypium raimondii GN=B456_008G113200 PE=4 SV=1) HSP 1 Score: 110.5 bits (275), Expect = 8.0e-22 Identity = 48/68 (70.59%), Postives = 62/68 (91.18%), Query Frame = -2
BLAST of CU156305 vs. TrEMBL
Match: A0A0D3DUP1_BRAOL (Pectinesterase OS=Brassica oleracea var. oleracea PE=4 SV=1) HSP 1 Score: 110.2 bits (274), Expect = 1.0e-21 Identity = 51/68 (75.00%), Postives = 59/68 (86.76%), Query Frame = -2
BLAST of CU156305 vs. NCBI nr
Match: gi|700201482|gb|KGN56615.1| (hypothetical protein Csa_3G126790 [Cucumis sativus]) HSP 1 Score: 145.6 bits (366), Expect = 3.2e-32 Identity = 69/69 (100.00%), Postives = 69/69 (100.00%), Query Frame = -2
BLAST of CU156305 vs. NCBI nr
Match: gi|778677487|ref|XP_004134349.2| (PREDICTED: probable pectinesterase/pectinesterase inhibitor 36 [Cucumis sativus]) HSP 1 Score: 145.6 bits (366), Expect = 3.2e-32 Identity = 69/69 (100.00%), Postives = 69/69 (100.00%), Query Frame = -2
BLAST of CU156305 vs. NCBI nr
Match: gi|659075523|ref|XP_008438191.1| (PREDICTED: probable pectinesterase/pectinesterase inhibitor 36 isoform X1 [Cucumis melo]) HSP 1 Score: 134.4 bits (337), Expect = 7.5e-29 Identity = 63/69 (91.30%), Postives = 65/69 (94.20%), Query Frame = -2
BLAST of CU156305 vs. NCBI nr
Match: gi|659075525|ref|XP_008438192.1| (PREDICTED: probable pectinesterase/pectinesterase inhibitor 36 isoform X2 [Cucumis melo]) HSP 1 Score: 118.6 bits (296), Expect = 4.2e-24 Identity = 55/67 (82.09%), Postives = 57/67 (85.07%), Query Frame = -1
BLAST of CU156305 vs. NCBI nr
Match: gi|870847706|gb|KMT00054.1| (hypothetical protein BVRB_1g018820 [Beta vulgaris subsp. vulgaris]) HSP 1 Score: 115.9 bits (289), Expect = 2.7e-23 Identity = 52/68 (76.47%), Postives = 59/68 (86.76%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|