CU156215 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGCAGCGCTGAGGCCAAATTTCCTCACATATTCCTAAACTCATAGCTCTGTATTCAGCCTCAGCGCTGCTCCTGGCCACAACACTTTGCTTCTTACTCCTCCACGTTACAAGATTTCCCCAAACAAAGGTACAATAACCAAAGGTAGATTTCCTGTCAACAACAGATCCTGCACAATCCGAGTCAGTGTATGC
BLAST of CU156215 vs. Swiss-Prot
Match: M810_ARATH (Uncharacterized mitochondrial protein AtMg00810 OS=Arabidopsis thaliana GN=AtMg00810 PE=4 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 1.9e-10 Identity = 29/60 (48.33%), Postives = 39/60 (65.00%), Query Frame = -1
BLAST of CU156215 vs. Swiss-Prot
Match: COPIA_DROME (Copia protein OS=Drosophila melanogaster GN=GIP PE=1 SV=3) HSP 1 Score: 59.7 bits (143), Expect = 1.4e-08 Identity = 30/60 (50.00%), Postives = 38/60 (63.33%), Query Frame = -1
BLAST of CU156215 vs. Swiss-Prot
Match: POLX_TOBAC (Retrovirus-related Pol polyprotein from transposon TNT 1-94 OS=Nicotiana tabacum PE=2 SV=1) HSP 1 Score: 53.1 bits (126), Expect = 1.3e-06 Identity = 28/62 (45.16%), Postives = 36/62 (58.06%), Query Frame = -1
BLAST of CU156215 vs. TrEMBL
Match: Q04357_SOLTU (Potato DNA for copia-like transposable element OS=Solanum tuberosum PE=4 SV=1) HSP 1 Score: 110.2 bits (274), Expect = 9.7e-22 Identity = 50/63 (79.37%), Postives = 58/63 (92.06%), Query Frame = -1
BLAST of CU156215 vs. TrEMBL
Match: A5BTF0_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_025852 PE=4 SV=1) HSP 1 Score: 109.0 bits (271), Expect = 2.2e-21 Identity = 47/62 (75.81%), Postives = 58/62 (93.55%), Query Frame = -1
BLAST of CU156215 vs. TrEMBL
Match: A5BTF0_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_025852 PE=4 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 1.5e-09 Identity = 30/50 (60.00%), Postives = 41/50 (82.00%), Query Frame = -1
HSP 2 Score: 108.2 bits (269), Expect = 3.7e-21 Identity = 48/60 (80.00%), Postives = 56/60 (93.33%), Query Frame = -1
BLAST of CU156215 vs. TrEMBL
Match: W9R7J3_9ROSA (Copia protein OS=Morus notabilis GN=L484_007434 PE=4 SV=1) HSP 1 Score: 106.7 bits (265), Expect = 1.1e-20 Identity = 50/63 (79.37%), Postives = 55/63 (87.30%), Query Frame = -1
BLAST of CU156215 vs. TrEMBL
Match: A5B5I8_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_032051 PE=4 SV=1) HSP 1 Score: 106.7 bits (265), Expect = 1.1e-20 Identity = 47/62 (75.81%), Postives = 57/62 (91.94%), Query Frame = -1
BLAST of CU156215 vs. NCBI nr
Match: gi|21434|emb|CAA36616.1| (unnamed protein product [Solanum tuberosum]) HSP 1 Score: 110.9 bits (276), Expect = 8.2e-22 Identity = 50/63 (79.37%), Postives = 58/63 (92.06%), Query Frame = -1
BLAST of CU156215 vs. NCBI nr
Match: gi|147860623|emb|CAN83575.1| (hypothetical protein VITISV_025852 [Vitis vinifera]) HSP 1 Score: 109.8 bits (273), Expect = 1.8e-21 Identity = 47/62 (75.81%), Postives = 58/62 (93.55%), Query Frame = -1
BLAST of CU156215 vs. NCBI nr
Match: gi|823126801|ref|XP_012491126.1| (PREDICTED: LOW QUALITY PROTEIN: uncharacterized protein LOC105803458, partial [Gossypium raimondii]) HSP 1 Score: 108.6 bits (270), Expect = 4.1e-21 Identity = 50/62 (80.65%), Postives = 56/62 (90.32%), Query Frame = -1
BLAST of CU156215 vs. NCBI nr
Match: gi|147790213|emb|CAN65603.1| (hypothetical protein VITISV_021511 [Vitis vinifera]) HSP 1 Score: 108.6 bits (270), Expect = 4.1e-21 Identity = 48/60 (80.00%), Postives = 56/60 (93.33%), Query Frame = -1
BLAST of CU156215 vs. NCBI nr
Match: gi|703095637|ref|XP_010095595.1| (Copia protein [Morus notabilis]) HSP 1 Score: 107.5 bits (267), Expect = 9.1e-21 Identity = 50/63 (79.37%), Postives = 55/63 (87.30%), Query Frame = -1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|