CU154156 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TTTTTCTCCTATGACTGAAGCCGAAGAGTTTTTAGGATAAAGTTCTTTACTATTTCAGGCTCCCCATTCATTAGAAAAGCAAAACGCACTTGGGACGAAGTCTCTTACAAAACACTTTGATCATAGTTAAGATTTTCTTCAGTACTGTCCAACGCCGCAATAGTACCAACTGGCTGGC
BLAST of CU154156 vs. Swiss-Prot
Match: INVB_ARATH (Probable alkaline/neutral invertase B OS=Arabidopsis thaliana GN=INVB PE=1 SV=1) HSP 1 Score: 73.6 bits (179), Expect = 8.2e-13 Identity = 39/58 (67.24%), Postives = 44/58 (75.86%), Query Frame = -3
BLAST of CU154156 vs. Swiss-Prot
Match: CINV2_ARATH (Alkaline/neutral invertase CINV2 OS=Arabidopsis thaliana GN=CINV2 PE=1 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 6.5e-10 Identity = 37/59 (62.71%), Postives = 42/59 (71.19%), Query Frame = -3
BLAST of CU154156 vs. Swiss-Prot
Match: INVD_ARATH (Probable alkaline/neutral invertase D OS=Arabidopsis thaliana GN=INVD PE=2 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 6.5e-10 Identity = 36/59 (61.02%), Postives = 42/59 (71.19%), Query Frame = -3
BLAST of CU154156 vs. Swiss-Prot
Match: CINV1_ARATH (Alkaline/neutral invertase CINV1 OS=Arabidopsis thaliana GN=CINV1 PE=1 SV=1) HSP 1 Score: 62.4 bits (150), Expect = 1.9e-09 Identity = 36/59 (61.02%), Postives = 42/59 (71.19%), Query Frame = -3
BLAST of CU154156 vs. Swiss-Prot
Match: INVF_ARATH (Probable alkaline/neutral invertase F OS=Arabidopsis thaliana GN=INVF PE=2 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 4.2e-09 Identity = 35/59 (59.32%), Postives = 41/59 (69.49%), Query Frame = -3
BLAST of CU154156 vs. TrEMBL
Match: A0A0A0K5W2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G009210 PE=4 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 6.8e-14 Identity = 46/58 (79.31%), Postives = 48/58 (82.76%), Query Frame = -3
BLAST of CU154156 vs. TrEMBL
Match: A0A0D2NI51_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_005G252100 PE=4 SV=1) HSP 1 Score: 80.5 bits (197), Expect = 7.5e-13 Identity = 44/58 (75.86%), Postives = 47/58 (81.03%), Query Frame = -3
BLAST of CU154156 vs. TrEMBL
Match: A0A0B0PU09_GOSAR (Protein degV OS=Gossypium arboreum GN=F383_08817 PE=4 SV=1) HSP 1 Score: 80.5 bits (197), Expect = 7.5e-13 Identity = 44/58 (75.86%), Postives = 47/58 (81.03%), Query Frame = -3
BLAST of CU154156 vs. TrEMBL
Match: S4SKC1_ACTCH (Neutral invertase OS=Actinidia chinensis GN=NIK PE=2 SV=1) HSP 1 Score: 78.2 bits (191), Expect = 3.7e-12 Identity = 43/57 (75.44%), Postives = 46/57 (80.70%), Query Frame = -3
BLAST of CU154156 vs. TrEMBL
Match: A0A068TLY6_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00014151001 PE=4 SV=1) HSP 1 Score: 77.8 bits (190), Expect = 4.9e-12 Identity = 43/58 (74.14%), Postives = 46/58 (79.31%), Query Frame = -3
BLAST of CU154156 vs. NCBI nr
Match: gi|449454175|ref|XP_004144831.1| (PREDICTED: probable alkaline/neutral invertase B [Cucumis sativus]) HSP 1 Score: 85.1 bits (209), Expect = 4.4e-14 Identity = 46/58 (79.31%), Postives = 48/58 (82.76%), Query Frame = -3
BLAST of CU154156 vs. NCBI nr
Match: gi|659094308|ref|XP_008447991.1| (PREDICTED: alkaline/neutral invertase CINV2 [Cucumis melo]) HSP 1 Score: 85.1 bits (209), Expect = 4.4e-14 Identity = 46/58 (79.31%), Postives = 48/58 (82.76%), Query Frame = -3
BLAST of CU154156 vs. NCBI nr
Match: gi|823161159|ref|XP_012480445.1| (PREDICTED: probable alkaline/neutral invertase B [Gossypium raimondii]) HSP 1 Score: 81.6 bits (200), Expect = 4.8e-13 Identity = 44/58 (75.86%), Postives = 47/58 (81.03%), Query Frame = -3
BLAST of CU154156 vs. NCBI nr
Match: gi|728850530|gb|KHG29973.1| (Protein degV [Gossypium arboreum]) HSP 1 Score: 81.6 bits (200), Expect = 4.8e-13 Identity = 44/58 (75.86%), Postives = 47/58 (81.03%), Query Frame = -3
BLAST of CU154156 vs. NCBI nr
Match: gi|747082380|ref|XP_011088508.1| (PREDICTED: alkaline/neutral invertase CINV2-like [Sesamum indicum]) HSP 1 Score: 80.1 bits (196), Expect = 1.4e-12 Identity = 43/58 (74.14%), Postives = 47/58 (81.03%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|