CU154145 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GTGAAGAATCATACAAGGATAGCACCTTGATCATGCAACTCCTCCGAGACAACTTGACTCTTTGGACTTCTGATATTGGGGATGAAGCTGGCGATGAGATTAAGGAAGCATCAAAACGTGAATCGAGGGGGAGGACATGGACAGTTAGTTGCGTTGTTGTGAGTTG
BLAST of CU154145 vs. Swiss-Prot
Match: 1433_LILLO (14-3-3-like protein OS=Lilium longiflorum PE=2 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 3.4e-13 Identity = 36/38 (94.74%), Postives = 35/38 (92.11%), Query Frame = 3
BLAST of CU154145 vs. Swiss-Prot
Match: 14333_ARATH (14-3-3-like protein GF14 psi OS=Arabidopsis thaliana GN=GRF3 PE=1 SV=2) HSP 1 Score: 74.3 bits (181), Expect = 4.5e-13 Identity = 36/38 (94.74%), Postives = 35/38 (92.11%), Query Frame = 3
BLAST of CU154145 vs. Swiss-Prot
Match: 14334_SOLLC (14-3-3 protein 4 OS=Solanum lycopersicum GN=TFT4 PE=2 SV=1) HSP 1 Score: 72.4 bits (176), Expect = 1.7e-12 Identity = 35/41 (85.37%), Postives = 35/41 (85.37%), Query Frame = 3
BLAST of CU154145 vs. Swiss-Prot
Match: 14335_ARATH (14-3-3-like protein GF14 upsilon OS=Arabidopsis thaliana GN=GRF5 PE=1 SV=2) HSP 1 Score: 72.4 bits (176), Expect = 1.7e-12 Identity = 34/38 (89.47%), Postives = 34/38 (89.47%), Query Frame = 3
BLAST of CU154145 vs. Swiss-Prot
Match: 1433A_SOYBN (14-3-3-like protein A OS=Glycine max GN=GF14A PE=2 SV=1) HSP 1 Score: 72.0 bits (175), Expect = 2.2e-12 Identity = 35/40 (87.50%), Postives = 35/40 (87.50%), Query Frame = 3
BLAST of CU154145 vs. TrEMBL
Match: A0A0A0KVK8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G094520 PE=3 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 6.3e-14 Identity = 41/41 (100.00%), Postives = 41/41 (100.00%), Query Frame = 3
BLAST of CU154145 vs. TrEMBL
Match: F2YZ44_HEVBR (14-3-3 protein 3 OS=Hevea brasiliensis PE=2 SV=1) HSP 1 Score: 81.6 bits (200), Expect = 3.1e-13 Identity = 40/41 (97.56%), Postives = 40/41 (97.56%), Query Frame = 3
BLAST of CU154145 vs. TrEMBL
Match: F2YZ43_HEVBR (14-3-3 protein 2 OS=Hevea brasiliensis PE=2 SV=1) HSP 1 Score: 80.9 bits (198), Expect = 5.3e-13 Identity = 40/41 (97.56%), Postives = 40/41 (97.56%), Query Frame = 3
BLAST of CU154145 vs. TrEMBL
Match: A0A067KD35_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_12969 PE=3 SV=1) HSP 1 Score: 80.9 bits (198), Expect = 5.3e-13 Identity = 40/41 (97.56%), Postives = 40/41 (97.56%), Query Frame = 3
BLAST of CU154145 vs. TrEMBL
Match: D5IBV3_MANES (14-3-3 protein OS=Manihot esculenta PE=2 SV=1) HSP 1 Score: 80.9 bits (198), Expect = 5.3e-13 Identity = 40/41 (97.56%), Postives = 40/41 (97.56%), Query Frame = 3
BLAST of CU154145 vs. NCBI nr
Match: gi|449438841|ref|XP_004137196.1| (PREDICTED: 14-3-3-like protein [Cucumis sativus]) HSP 1 Score: 84.0 bits (206), Expect = 9.0e-14 Identity = 41/41 (100.00%), Postives = 41/41 (100.00%), Query Frame = 3
BLAST of CU154145 vs. NCBI nr
Match: gi|326694867|gb|AEA03664.1| (14-3-3 protein 3 [Hevea brasiliensis]) HSP 1 Score: 81.6 bits (200), Expect = 4.5e-13 Identity = 40/41 (97.56%), Postives = 40/41 (97.56%), Query Frame = 3
BLAST of CU154145 vs. NCBI nr
Match: gi|802634322|ref|XP_012077948.1| (PREDICTED: 14-3-3-like protein A [Jatropha curcas]) HSP 1 Score: 80.9 bits (198), Expect = 7.7e-13 Identity = 40/41 (97.56%), Postives = 40/41 (97.56%), Query Frame = 3
BLAST of CU154145 vs. NCBI nr
Match: gi|291293221|gb|ADD92154.1| (14-3-3 protein [Manihot esculenta]) HSP 1 Score: 80.9 bits (198), Expect = 7.7e-13 Identity = 40/41 (97.56%), Postives = 40/41 (97.56%), Query Frame = 3
BLAST of CU154145 vs. NCBI nr
Match: gi|326694865|gb|AEA03663.1| (14-3-3 protein 2 [Hevea brasiliensis]) HSP 1 Score: 80.9 bits (198), Expect = 7.7e-13 Identity = 40/41 (97.56%), Postives = 40/41 (97.56%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|