CU153828 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CTGACGTGGAAAAATATCTCTCTAGTACCATCATGGCCGCATAGGCATCAATCTTCTTCTGCCTAGTAGATTTATTGAGACCCCTGGAAATCATATGGCTTTCCGCTTCTGCTGTTGTACCATGTTCATCATACAAGTAAACTCTCCAGCCCCTT
BLAST of CU153828 vs. TrEMBL
Match: A0A0A0L3L5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G116900 PE=3 SV=1) HSP 1 Score: 106.7 bits (265), Expect = 8.6e-21 Identity = 51/51 (100.00%), Postives = 51/51 (100.00%), Query Frame = -2
BLAST of CU153828 vs. TrEMBL
Match: B9N0F0_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0004s23400g PE=3 SV=1) HSP 1 Score: 86.7 bits (213), Expect = 9.2e-15 Identity = 40/50 (80.00%), Postives = 44/50 (88.00%), Query Frame = -2
BLAST of CU153828 vs. TrEMBL
Match: A0A059AUC6_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_H00160 PE=3 SV=1) HSP 1 Score: 84.3 bits (207), Expect = 4.6e-14 Identity = 40/51 (78.43%), Postives = 44/51 (86.27%), Query Frame = -2
BLAST of CU153828 vs. TrEMBL
Match: A0A0R0KEA6_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_03G033200 PE=3 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 6.0e-14 Identity = 39/51 (76.47%), Postives = 45/51 (88.24%), Query Frame = -2
BLAST of CU153828 vs. TrEMBL
Match: A0A0B2QT40_GLYSO (Putative Holliday junction resolvase OS=Glycine soja GN=glysoja_044459 PE=3 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 6.0e-14 Identity = 39/51 (76.47%), Postives = 45/51 (88.24%), Query Frame = -2
BLAST of CU153828 vs. NCBI nr
Match: gi|449431960|ref|XP_004133768.1| (PREDICTED: uncharacterized protein LOC101219287 isoform X1 [Cucumis sativus]) HSP 1 Score: 106.7 bits (265), Expect = 1.2e-20 Identity = 51/51 (100.00%), Postives = 51/51 (100.00%), Query Frame = -2
BLAST of CU153828 vs. NCBI nr
Match: gi|659074761|ref|XP_008437782.1| (PREDICTED: uncharacterized protein LOC103483114 [Cucumis melo]) HSP 1 Score: 100.9 bits (250), Expect = 6.8e-19 Identity = 48/51 (94.12%), Postives = 49/51 (96.08%), Query Frame = -2
BLAST of CU153828 vs. NCBI nr
Match: gi|778676650|ref|XP_011650631.1| (PREDICTED: uncharacterized protein LOC101219287 isoform X2 [Cucumis sativus]) HSP 1 Score: 88.2 bits (217), Expect = 4.5e-15 Identity = 41/42 (97.62%), Postives = 42/42 (100.00%), Query Frame = -2
BLAST of CU153828 vs. NCBI nr
Match: gi|566168242|ref|XP_006385047.1| (hypothetical protein POPTR_0004s23400g [Populus trichocarpa]) HSP 1 Score: 86.7 bits (213), Expect = 1.3e-14 Identity = 40/50 (80.00%), Postives = 44/50 (88.00%), Query Frame = -2
BLAST of CU153828 vs. NCBI nr
Match: gi|743848990|ref|XP_011028361.1| (PREDICTED: uncharacterized protein LOC105128407 [Populus euphratica]) HSP 1 Score: 86.7 bits (213), Expect = 1.3e-14 Identity = 40/50 (80.00%), Postives = 44/50 (88.00%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|