CU153725 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TAAATTACTTTTGGTATTGTCCTAATTTATTCAAGATTCAGGAAAAGGAAGGCTGAACCTCTTCCCCGGCTTCATGGATAGATACAATAAATCTATTGCCAAGGATGCAATAACTGAATACGTGCAGTTGGCCAAAAAGTCTGGCCTAACTCCAGTACAGCT
BLAST of CU153725 vs. TrEMBL
Match: A0A0A0LPX0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G031740 PE=4 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 7.3e-15 Identity = 42/43 (97.67%), Postives = 42/43 (97.67%), Query Frame = 2
BLAST of CU153725 vs. TrEMBL
Match: A0A0B0PIP2_GOSAR (Protein tas OS=Gossypium arboreum GN=F383_09383 PE=4 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 1.7e-08 Identity = 28/39 (71.79%), Postives = 36/39 (92.31%), Query Frame = 2
BLAST of CU153725 vs. TrEMBL
Match: A0A068TTH9_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00026317001 PE=4 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 2.3e-08 Identity = 28/39 (71.79%), Postives = 36/39 (92.31%), Query Frame = 2
BLAST of CU153725 vs. TrEMBL
Match: Q10GW1_ORYSJ (Oxidoreductase, aldo/keto reductase family protein, expressed OS=Oryza sativa subsp. japonica GN=LOC_Os03g41510 PE=4 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 3.0e-08 Identity = 30/41 (73.17%), Postives = 35/41 (85.37%), Query Frame = 2
BLAST of CU153725 vs. TrEMBL
Match: A0A0D3FL89_9ORYZ (Uncharacterized protein OS=Oryza barthii PE=4 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 3.0e-08 Identity = 30/41 (73.17%), Postives = 35/41 (85.37%), Query Frame = 2
BLAST of CU153725 vs. NCBI nr
Match: gi|449439219|ref|XP_004137384.1| (PREDICTED: aldo-keto reductase [Cucumis sativus]) HSP 1 Score: 88.6 bits (218), Expect = 3.6e-15 Identity = 42/43 (97.67%), Postives = 42/43 (97.67%), Query Frame = 2
BLAST of CU153725 vs. NCBI nr
Match: gi|700208854|gb|KGN63950.1| (hypothetical protein Csa_1G031740 [Cucumis sativus]) HSP 1 Score: 88.6 bits (218), Expect = 3.6e-15 Identity = 42/43 (97.67%), Postives = 42/43 (97.67%), Query Frame = 2
BLAST of CU153725 vs. NCBI nr
Match: gi|659068729|ref|XP_008445879.1| (PREDICTED: homeobox-leucine zipper protein HDG11-like [Cucumis melo]) HSP 1 Score: 85.1 bits (209), Expect = 4.0e-14 Identity = 40/43 (93.02%), Postives = 42/43 (97.67%), Query Frame = 2
BLAST of CU153725 vs. NCBI nr
Match: gi|720095759|ref|XP_010246778.1| (PREDICTED: aldo-keto reductase [Nelumbo nucifera]) HSP 1 Score: 68.2 bits (165), Expect = 5.0e-09 Identity = 31/39 (79.49%), Postives = 35/39 (89.74%), Query Frame = 2
BLAST of CU153725 vs. NCBI nr
Match: gi|357121148|ref|XP_003562283.1| (PREDICTED: protein tas-like [Brachypodium distachyon]) HSP 1 Score: 66.6 bits (161), Expect = 1.5e-08 Identity = 29/42 (69.05%), Postives = 36/42 (85.71%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|