CU152808 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TCATTATGCGTTGTTGGGTTTGAGTCATTTAAGATATCTAGCGACTGAGGAACAGATAAGAAAAAGTTATCGAGAAACTGCTTTGAAGTATCATCCTGACAAACAAGCTGCGCTTCTTCTTGCTGAGGAAACTGAAGCTGACAAAACAGCAAAGAAGGATGAAATAGAAAGTCAACTTTTAAATCTATTCAAGAAGCGTATGAAGTGT
BLAST of CU152808 vs. TrEMBL
Match: A0A0A0LAD6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G223330 PE=4 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 2.9e-11 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = 2
BLAST of CU152808 vs. TrEMBL
Match: M5VIQ8_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa002636mg PE=4 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 2.9e-11 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = 2
BLAST of CU152808 vs. TrEMBL
Match: A0A067ENI8_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g006420mg PE=4 SV=1) HSP 1 Score: 74.3 bits (181), Expect = 6.4e-11 Identity = 34/35 (97.14%), Postives = 35/35 (100.00%), Query Frame = 2
BLAST of CU152808 vs. TrEMBL
Match: V4S5H7_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10011261mg PE=4 SV=1) HSP 1 Score: 74.3 bits (181), Expect = 6.4e-11 Identity = 34/35 (97.14%), Postives = 35/35 (100.00%), Query Frame = 2
BLAST of CU152808 vs. TrEMBL
Match: B9SS17_RICCO (Zuotin, putative OS=Ricinus communis GN=RCOM_0519910 PE=4 SV=1) HSP 1 Score: 73.6 bits (179), Expect = 1.1e-10 Identity = 34/35 (97.14%), Postives = 34/35 (97.14%), Query Frame = 2
BLAST of CU152808 vs. NCBI nr
Match: gi|645260575|ref|XP_008235893.1| (PREDICTED: dnaJ homolog subfamily C member 2-like [Prunus mume]) HSP 1 Score: 74.7 bits (182), Expect = 7.0e-11 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = 2
BLAST of CU152808 vs. NCBI nr
Match: gi|449457039|ref|XP_004146256.1| (PREDICTED: dnaJ homolog subfamily C member 2-like [Cucumis sativus]) HSP 1 Score: 74.7 bits (182), Expect = 7.0e-11 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = 2
BLAST of CU152808 vs. NCBI nr
Match: gi|694411784|ref|XP_009334242.1| (PREDICTED: dnaJ homolog subfamily C member 2-like [Pyrus x bretschneideri]) HSP 1 Score: 74.7 bits (182), Expect = 7.0e-11 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = 2
BLAST of CU152808 vs. NCBI nr
Match: gi|658027066|ref|XP_008348963.1| (PREDICTED: dnaJ homolog subfamily C member 2-like [Malus domestica]) HSP 1 Score: 74.7 bits (182), Expect = 7.0e-11 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = 2
BLAST of CU152808 vs. NCBI nr
Match: gi|595791969|ref|XP_007199733.1| (hypothetical protein PRUPE_ppa002636mg [Prunus persica]) HSP 1 Score: 74.7 bits (182), Expect = 7.0e-11 Identity = 35/35 (100.00%), Postives = 35/35 (100.00%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|