CU152783 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ACCATGTATGAAGTCATACGTTTCGTTAGGTTATAACGTTGACATTGCCTCACACCAATTTTGATATGTTCCAATAAGTCCCCGTTCGTAAATGACTCCAAGGGTGTTAAAATCTGCTTCGACGAGGGATGATGTTCATGACCCACAGAGGATCATCAACGATGGCAGCTGCAAAACCACCCAAGAACGAGTTCATGTCAAGCAAATT
BLAST of CU152783 vs. Swiss-Prot
Match: PMTF_ARATH (Probable methyltransferase PMT15 OS=Arabidopsis thaliana GN=At4g00750 PE=2 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 5.4e-11 Identity = 33/40 (82.50%), Postives = 31/40 (77.50%), Query Frame = -2
HSP 2 Score: 52.0 bits (123), Expect = 3.0e-06 Identity = 20/28 (71.43%), Postives = 24/28 (85.71%), Query Frame = -1
BLAST of CU152783 vs. Swiss-Prot
Match: PMTG_ARATH (Probable methyltransferase PMT16 OS=Arabidopsis thaliana GN=At2g45750 PE=3 SV=1) HSP 1 Score: 67.8 bits (164), Expect = 5.4e-11 Identity = 33/40 (82.50%), Postives = 31/40 (77.50%), Query Frame = -2
HSP 2 Score: 53.5 bits (127), Expect = 1.0e-06 Identity = 20/28 (71.43%), Postives = 25/28 (89.29%), Query Frame = -1
BLAST of CU152783 vs. Swiss-Prot
Match: PMTH_ARATH (Probable methyltransferase PMT17 OS=Arabidopsis thaliana GN=At4g10440 PE=3 SV=1) HSP 1 Score: 56.6 bits (135), Expect = 1.2e-07 Identity = 27/40 (67.50%), Postives = 28/40 (70.00%), Query Frame = -2
HSP 2 Score: 45.8 bits (107), Expect = 2.2e-04 Identity = 17/28 (60.71%), Postives = 23/28 (82.14%), Query Frame = -1
BLAST of CU152783 vs. Swiss-Prot
Match: PMTJ_ARATH (Probable methyltransferase PMT19 OS=Arabidopsis thaliana GN=At2g43200 PE=3 SV=1) HSP 1 Score: 56.2 bits (134), Expect = 1.6e-07 Identity = 25/35 (71.43%), Postives = 26/35 (74.29%), Query Frame = -2
HSP 2 Score: 45.8 bits (107), Expect = 2.2e-04 Identity = 17/28 (60.71%), Postives = 23/28 (82.14%), Query Frame = -1
BLAST of CU152783 vs. Swiss-Prot
Match: PMTI_ARATH (Probable methyltransferase PMT18 OS=Arabidopsis thaliana GN=At1g33170 PE=2 SV=1) HSP 1 Score: 53.5 bits (127), Expect = 1.0e-06 Identity = 25/40 (62.50%), Postives = 27/40 (67.50%), Query Frame = -2
HSP 2 Score: 45.8 bits (107), Expect = 2.2e-04 Identity = 17/28 (60.71%), Postives = 23/28 (82.14%), Query Frame = -1
BLAST of CU152783 vs. TrEMBL
Match: A0A0A0L3P2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G123720 PE=4 SV=1) HSP 1 Score: 72.8 bits (177), Expect = 1.9e-10 Identity = 35/40 (87.50%), Postives = 35/40 (87.50%), Query Frame = -2
BLAST of CU152783 vs. TrEMBL
Match: A0A0A0L3P2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G123720 PE=4 SV=1) HSP 1 Score: 61.6 bits (148), Expect = 4.3e-07 Identity = 28/33 (84.85%), Postives = 30/33 (90.91%), Query Frame = -1
HSP 2 Score: 71.2 bits (173), Expect = 5.4e-10 Identity = 34/40 (85.00%), Postives = 35/40 (87.50%), Query Frame = -2
BLAST of CU152783 vs. TrEMBL
Match: A0A0L9U345_PHAAN (Uncharacterized protein OS=Phaseolus angularis GN=LR48_Vigan03g059100 PE=4 SV=1) HSP 1 Score: 58.2 bits (139), Expect = 4.7e-06 Identity = 24/33 (72.73%), Postives = 29/33 (87.88%), Query Frame = -1
HSP 2 Score: 71.2 bits (173), Expect = 5.4e-10 Identity = 34/40 (85.00%), Postives = 35/40 (87.50%), Query Frame = -2
BLAST of CU152783 vs. TrEMBL
Match: A0A0S3RT49_PHAAN (Uncharacterized protein OS=Vigna angularis var. angularis GN=Vigan.04G099800 PE=4 SV=1) HSP 1 Score: 58.2 bits (139), Expect = 4.7e-06 Identity = 24/33 (72.73%), Postives = 29/33 (87.88%), Query Frame = -1
HSP 2 Score: 68.9 bits (167), Expect = 2.7e-09 Identity = 33/40 (82.50%), Postives = 34/40 (85.00%), Query Frame = -2
BLAST of CU152783 vs. TrEMBL
Match: A0A072TP47_MEDTR (Methyltransferase OS=Medicago truncatula GN=MTR_8g432680 PE=4 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 6.2e-06 Identity = 24/28 (85.71%), Postives = 28/28 (100.00%), Query Frame = -1
HSP 2 Score: 68.6 bits (166), Expect = 3.5e-09 Identity = 32/40 (80.00%), Postives = 34/40 (85.00%), Query Frame = -2
BLAST of CU152783 vs. NCBI nr
Match: gi|778677304|ref|XP_011650766.1| (PREDICTED: probable methyltransferase PMT16 [Cucumis sativus]) HSP 1 Score: 76.3 bits (186), Expect = 2.4e-11 Identity = 35/40 (87.50%), Postives = 35/40 (87.50%), Query Frame = -2
BLAST of CU152783 vs. NCBI nr
Match: gi|700201417|gb|KGN56550.1| (hypothetical protein Csa_3G123720 [Cucumis sativus]) HSP 1 Score: 76.3 bits (186), Expect = 2.4e-11 Identity = 35/40 (87.50%), Postives = 35/40 (87.50%), Query Frame = -2
BLAST of CU152783 vs. NCBI nr
Match: gi|659075340|ref|XP_008438092.1| (PREDICTED: probable methyltransferase PMT15 [Cucumis melo]) HSP 1 Score: 76.3 bits (186), Expect = 2.4e-11 Identity = 35/40 (87.50%), Postives = 35/40 (87.50%), Query Frame = -2
BLAST of CU152783 vs. NCBI nr
Match: gi|965669171|dbj|BAT83778.1| (hypothetical protein VIGAN_04099800 [Vigna angularis var. angularis]) HSP 1 Score: 74.7 bits (182), Expect = 7.0e-11 Identity = 34/40 (85.00%), Postives = 35/40 (87.50%), Query Frame = -2
BLAST of CU152783 vs. NCBI nr
Match: gi|920693985|gb|KOM37210.1| (hypothetical protein LR48_Vigan03g059100 [Vigna angularis]) HSP 1 Score: 74.7 bits (182), Expect = 7.0e-11 Identity = 34/40 (85.00%), Postives = 35/40 (87.50%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|