CU151987 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CATTTGTGCACTGCACTTTTGTTGTCCGAGCTGAAGGAGATGAAGGAACGAATGGAAAAACCAACGCATCTACGAGGCTTCGGGAAGGGCATACGTTCTATCAGGACTAAGCTCTCATTCATGGCAACGAGCCACTGCACGTGGT
BLAST of CU151987 vs. TrEMBL
Match: A0A0A0LXX5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G124000 PE=4 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 3.5e-08 Identity = 32/47 (68.09%), Postives = 35/47 (74.47%), Query Frame = 2
BLAST of CU151987 vs. TrEMBL
Match: A0A0A0LXX5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G124000 PE=4 SV=1) HSP 1 Score: 32.0 bits (71), Expect = 2.5e+02 Identity = 16/19 (84.21%), Postives = 17/19 (89.47%), Query Frame = 1
HSP 2 Score: 60.5 bits (145), Expect = 6.6e-07 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = 2
BLAST of CU151987 vs. TrEMBL
Match: A5BI34_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_037547 PE=4 SV=1) HSP 1 Score: 60.5 bits (145), Expect = 6.6e-07 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = 2
BLAST of CU151987 vs. TrEMBL
Match: A0A151TNF1_CAJCA (Uncharacterized protein OS=Cajanus cajan GN=KK1_022181 PE=4 SV=1) HSP 1 Score: 60.1 bits (144), Expect = 8.7e-07 Identity = 28/29 (96.55%), Postives = 28/29 (96.55%), Query Frame = 2
BLAST of CU151987 vs. TrEMBL
Match: A0A0B2PDF5_GLYSO (Uncharacterized protein OS=Glycine soja GN=glysoja_024633 PE=4 SV=1) HSP 1 Score: 59.7 bits (143), Expect = 1.1e-06 Identity = 27/29 (93.10%), Postives = 28/29 (96.55%), Query Frame = 2
BLAST of CU151987 vs. NCBI nr
Match: gi|659071949|ref|XP_008462750.1| (PREDICTED: uncharacterized protein LOC103501034 [Cucumis melo]) HSP 1 Score: 65.5 bits (158), Expect = 3.0e-08 Identity = 32/47 (68.09%), Postives = 35/47 (74.47%), Query Frame = 2
BLAST of CU151987 vs. NCBI nr
Match: gi|449443582|ref|XP_004139556.1| (PREDICTED: uncharacterized protein LOC101222940 [Cucumis sativus]) HSP 1 Score: 65.5 bits (158), Expect = 3.0e-08 Identity = 32/47 (68.09%), Postives = 35/47 (74.47%), Query Frame = 2
BLAST of CU151987 vs. NCBI nr
Match: gi|702272784|ref|XP_010043775.1| (PREDICTED: uncharacterized protein LOC104432891 isoform X2 [Eucalyptus grandis]) HSP 1 Score: 61.6 bits (148), Expect = 4.3e-07 Identity = 28/41 (68.29%), Postives = 33/41 (80.49%), Query Frame = 2
BLAST of CU151987 vs. NCBI nr
Match: gi|702272780|ref|XP_010043773.1| (PREDICTED: uncharacterized protein LOC104432891 isoform X1 [Eucalyptus grandis]) HSP 1 Score: 61.6 bits (148), Expect = 4.3e-07 Identity = 28/41 (68.29%), Postives = 33/41 (80.49%), Query Frame = 2
BLAST of CU151987 vs. NCBI nr
Match: gi|225435353|ref|XP_002285265.1| (PREDICTED: uncharacterized protein LOC100233041 [Vitis vinifera]) HSP 1 Score: 60.5 bits (145), Expect = 9.5e-07 Identity = 28/29 (96.55%), Postives = 29/29 (100.00%), Query Frame = 2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|