CU151935 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
TCATTGGCTGACAAGACGATATAATCAAGATCGAGCAACGGTTATATTGGAAAGCTAAGATCAAACTTTCTGGGAACCAAGTTCATTATATATGATAACACAGCCTCCTTACAACAGCAA
BLAST of CU151935 vs. Swiss-Prot
Match: TLP7_ORYSJ (Tubby-like F-box protein 7 OS=Oryza sativa subsp. japonica GN=TULP7 PE=2 SV=1) HSP 1 Score: 50.4 bits (119), Expect = 5.1e-06 Identity = 26/32 (81.25%), Postives = 26/32 (81.25%), Query Frame = 1
BLAST of CU151935 vs. Swiss-Prot
Match: TLP12_ORYSJ (Tubby-like F-box protein 12 OS=Oryza sativa subsp. japonica GN=TULP12 PE=2 SV=1) HSP 1 Score: 50.1 bits (118), Expect = 6.7e-06 Identity = 20/24 (83.33%), Postives = 22/24 (91.67%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|