CU151369 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGGGGATTTTCTTCCTGAGTGCTAGATGGTGGGGGGTCCGCAAGGGGTAGAACCATCGGGATCCGATCGTCCGTCAAAACTTAAGGTGTAGAAATAAAATGAAACAAAGTTGGAAAAGGGAAGGAGAGCGTTAAAAGAATTTGCGGCTGCAGAGGTCTATGGCAGGGGAAAAGTAGTGCAGAAAATGAAAACGAAGAGAGTGGGGAAATCAGTGCCGACGGAATGATGACAAAGAGTGGAAGCGG
BLAST of CU151369 vs. TrEMBL
Match: A0A0A0LPX5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G386170 PE=4 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 2.7e-08 Identity = 31/35 (88.57%), Postives = 34/35 (97.14%), Query Frame = 3
BLAST of CU151369 vs. NCBI nr
Match: gi|700207930|gb|KGN63049.1| (hypothetical protein Csa_2G386170 [Cucumis sativus]) HSP 1 Score: 65.1 bits (157), Expect = 6.5e-08 Identity = 31/35 (88.57%), Postives = 34/35 (97.14%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|